Miyakogusa Predicted Gene
- Lj5g3v2045580.2
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2045580.2 Non Chatacterized Hit- tr|I1MII4|I1MII4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.13860
PE,56.18,1e-18,seg,NULL,CUFF.56522.2
(246 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP064356 109 8e-24
>gnl|LJGI|BP064356
Length = 381
Score = 109 bits (55), Expect = 8e-24
Identities = 55/55 (100%)
Strand = Plus / Minus
Query: 191 atgtaattgatactgaaagggaatctgcgacagatttggaagcaagcggatcatg 245
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 185 atgtaattgatactgaaagggaatctgcgacagatttggaagcaagcggatcatg 131