Miyakogusa Predicted Gene

Lj5g3v2045210.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2045210.1 Non Chatacterized Hit- tr|I1LDY9|I1LDY9_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.44585
PE,92.23,0,seg,NULL; Piwi,Stem cell self-renewal protein Piwi;
PAZ,Argonaute/Dicer protein, PAZ; DUF1785,Domain,CUFF.56515.1
         (2400 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP042223 homologue to UniRef100_Q9XGW1 Cluster: Protein...   202   7e-51
gnl|LJGI|TC81970 homologue to UniRef100_A1E5M3 Cluster: Argonaut...    80   7e-14

>gnl|LJGI|BP042223 homologue to UniRef100_Q9XGW1 Cluster: Protein PINHEAD; n=2;
           Arabidopsis thaliana|Rep: Protein PINHEAD - Arabidopsis
           thaliana (Mouse-ear cress), partial (6%)
          Length = 252

 Score =  202 bits (102), Expect = 7e-51
 Identities = 154/169 (91%), Gaps = 3/169 (1%)
 Strand = Plus / Plus

                                                                       
Query: 814 aggtattgtcccattgggaggtccttcttttcacctgatattagaacaccacaacggctt 873
           |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 42  aggttttgccccattgggaggtccttcttttcacctgatattagaacaccacaacggctt 101

                                                                       
Query: 874 ggagagggattggagtcatggtgtggattttaccagagcataaggcctactcagatgggc 933
           ||  | |||||||| || ||||| ||| ||||||||||||||||||||||||||||||| 
Sbjct: 102 gggcaaggattggaatcttggtgcgga-tttaccagagcataaggcctactcagatgggt 160

                                                            
Query: 934 ctttcc--ctcaatattgatatggcatctgctgcattcattgaacctct 980
           ||||||  |||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 161 ctttccnnctcaatatagatatggcttctgctgcgttcattgaacctct 209


>gnl|LJGI|TC81970 homologue to UniRef100_A1E5M3 Cluster: Argonaute 1; n=1; Pisum
            sativum|Rep: Argonaute 1 - Pisum sativum (Garden pea),
            partial (31%)
          Length = 1029

 Score = 79.8 bits (40), Expect = 7e-14
 Identities = 136/168 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1450 gatccttatgcaaaggaatttggattgaatatcagtgaaaagctagcttctgtcgaagca 1509
            ||||||||||| ||||| |||||| | || |||||||| ||||| |||   || ||||| 
Sbjct: 206  gatccttatgctaaggagtttggaatcaaaatcagtgagaagcttgctcaagttgaagct 265

                                                                        
Query: 1510 cggattcttcctgccccatggcttaaatatcatgaaagtgggaaagagaagaactgttta 1569
            || ||||||||| | || ||||| ||||| ||||| | ||| | ||| ||| | ||| | 
Sbjct: 266  cgcattcttcctccaccttggctcaaataccatgatactggtagagaaaaggattgtctt 325

                                                            
Query: 1570 ccccaagttggtcagtggaatatgatgaacaagaaaatgattaatgga 1617
            || |||||||| || |||||||||||||||||||||||| | ||||||
Sbjct: 326  cctcaagttgggcaatggaatatgatgaacaagaaaatggtcaatgga 373