Miyakogusa Predicted Gene

Lj5g3v1986510.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1986510.1 Non Chatacterized Hit- tr|I1L2Z7|I1L2Z7_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,55.13,0.00001,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL; no
description,DNA-binding WRKY; WRKY,DNA-binding W,CUFF.56291.1
         (1023 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68313 similar to UniRef100_Q6IEP2 Cluster: WRKY trans...    70   3e-11
gnl|LJGI|TC77667 similar to UniRef100_A7QNH9 Cluster: Chromosome...    64   2e-09
gnl|LJGI|TC77072 similar to UniRef100_Q84J64 Cluster: WRKY trans...    62   7e-09
gnl|LJGI|TC62763 homologue to UniRef100_Q84J64 Cluster: WRKY tra...    62   7e-09
gnl|LJGI|TC76483 similar to UniRef100_A7LHF7 Cluster: WRKY8; n=1...    60   3e-08
gnl|LJGI|TC74899 similar to UniRef100_A7LHI5 Cluster: WRKY48; n=...    54   2e-06

>gnl|LJGI|TC68313 similar to UniRef100_Q6IEP2 Cluster: WRKY transcription factor 39;
           n=1; Oryza sativa Indica Group|Rep: WRKY transcription
           factor 39 - Oryza sativa subsp. indica (Rice), partial
           (9%)
          Length = 806

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                  
Query: 578 tgtgggcatggcgtaaatatggacaaaaacccatcaagggttctccatatccaag 632
           |||||| |||| | ||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 740 tgtgggaatggagaaaatatggacaaaaacccatcaaaggttctccgtatccaag 794


>gnl|LJGI|TC77667 similar to UniRef100_A7QNH9 Cluster: Chromosome chr2 scaffold_132,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr2 scaffold_132, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (33%)
          Length = 1369

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 579 gtgggcatggcgtaaatatggacaaaaacccatcaagggttctccatatccaaggaacta 638
           |||||| ||||||||||||||||| ||||| || |||||||| || |||||  | | |||
Sbjct: 543 gtgggcttggcgtaaatatggacagaaaccaataaagggttccccttatcctcgaagcta 602

                                   
Query: 639 ttacaggtgtagcagctccaaagg 662
            |||||||| |||||| |||||||
Sbjct: 603 ctacaggtgcagcagcaccaaagg 626


>gnl|LJGI|TC77072 similar to UniRef100_Q84J64 Cluster: WRKY transcription factor 22;
           n=1; Capsella rubella|Rep: WRKY transcription factor 22
           - Capsella rubella, partial (39%)
          Length = 1463

 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 580 tgggcatggcgtaaatatggacaaaaacccatcaagggttctccatatccaaggaactat 639
           ||||||||| | |||||||| || ||||| ||||| || || ||||||||||||   |||
Sbjct: 578 tgggcatggaggaaatatggtcagaaacctatcaaagggtcaccatatccaaggggatat 637

                                  
Query: 640 tacaggtgtagcagctccaaagg 662
           ||||| ||||||||||| |||||
Sbjct: 638 tacagatgtagcagctcaaaagg 660


>gnl|LJGI|TC62763 homologue to UniRef100_Q84J64 Cluster: WRKY transcription factor
           22; n=1; Capsella rubella|Rep: WRKY transcription factor
           22 - Capsella rubella, partial (38%)
          Length = 1383

 Score = 61.9 bits (31), Expect = 7e-09
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 580 tgggcatggcgtaaatatggacaaaaacccatcaagggttctccatatccaaggaactat 639
           ||||||||| | ||||||||||| |||||||| || || || ||||||||||||   || 
Sbjct: 590 tgggcatggaggaaatatggacagaaacccattaaagggtcaccatatccaaggggatac 649

                                  
Query: 640 tacaggtgtagcagctccaaagg 662
           ||||| ||||||||||| |||||
Sbjct: 650 tacagatgtagcagctcaaaagg 672


>gnl|LJGI|TC76483 similar to UniRef100_A7LHF7 Cluster: WRKY8; n=1; Glycine max|Rep:
           WRKY8 - Glycine max (Soybean), partial (65%)
          Length = 1208

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 592 aaatatggacaaaaacccatcaagggttctccatatccaagg 633
           |||||||||||||| || ||||| ||||||||||||||||||
Sbjct: 354 aaatatggacaaaagccaatcaaaggttctccatatccaagg 395


>gnl|LJGI|TC74899 similar to UniRef100_A7LHI5 Cluster: WRKY48; n=1; Glycine max|Rep:
           WRKY48 - Glycine max (Soybean), partial (46%)
          Length = 557

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 72/87 (82%)
 Strand = Plus / Plus

                                                                       
Query: 580 tgggcatggcgtaaatatggacaaaaacccatcaagggttctccatatccaaggaactat 639
           ||||||||| | || || || |||||||||||||| ||||| |||||||| ||    || 
Sbjct: 385 tgggcatggagaaagtacggccaaaaacccatcaaaggttccccatatcccagagggtac 444

                                      
Query: 640 tacaggtgtagcagctccaaaggttgt 666
           ||| |||||||||| ||||||||||||
Sbjct: 445 taccggtgtagcagttccaaaggttgt 471