Miyakogusa Predicted Gene

Lj5g3v1875230.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1875230.1 Non Chatacterized Hit- tr|I1NH81|I1NH81_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,97.83,0,PROTEIN_KINASE_DOM,Protein kinase, catalytic domain;
SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL,CUFF.56103.1
         (834 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68377 homologue to UniRef100_Q6BE26 Cluster: Somatic ...   462   e-129
gnl|LJGI|FS356573 homologue to UniRef100_A7L4A3 Cluster: Somatic...   450   e-126
gnl|LJGI|TC68728 similar to UniRef100_A7L4A8 Cluster: Somatic em...   256   2e-67
gnl|LJGI|AV410302 similar to UniRef100_Q94F62 Cluster: BRASSINOS...    72   6e-12

>gnl|LJGI|TC68377 homologue to UniRef100_Q6BE26 Cluster: Somatic embryogenesis
           receptor kinase 1; n=1; Citrus unshiu|Rep: Somatic
           embryogenesis receptor kinase 1 - Citrus unshiu (Satsuma
           orange), partial (21%)
          Length = 951

 Score =  462 bits (233), Expect = e-129
 Identities = 347/385 (90%)
 Strand = Plus / Plus

                                                                       
Query: 445 ctgattactggacaaagagcttttgaccttgctcggcttgcaaatgatgatgatgttatg 504
           ||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 1   ctgatcactggacaaagagcgtttgacctagctcggcttgcaaatgatgatgatgttatg 60

                                                                       
Query: 505 ctgcttgattgggtaaaaggtcttctgaaagagaaaaagcttgaaatgctggttgatcct 564
            ||||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 61  ttgcttgactgggtaaaaggacttctgaaagagaaaaaactagaaatgctggttgatcct 120

                                                                       
Query: 565 gatctacaaaccaactatatagaagctgaggtagaacagttaatccaggttgcactgctc 624
           ||||| || | ||| || |||||||||||||||||||||||||||||||||||||| || 
Sbjct: 121 gatctccacaacaattacatagaagctgaggtagaacagttaatccaggttgcactcctt 180

                                                                       
Query: 625 tgcacacaaggttccccaatggaacgaccaaagatgtcggaagtggtgagaatgcttgaa 684
           ||||| ||||||||||| ||||| || || || ||||| || |||||| | |||||||||
Sbjct: 181 tgcactcaaggttcccctatggaccggcctaaaatgtcagaggtggtgcgtatgcttgaa 240

                                                                       
Query: 685 ggtgatggcttggcagaaagatgggatgagtggcagaaagtggaagttctccgccaggaa 744
           ||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||| 
Sbjct: 241 ggtgatggcttggcagaaagatgggatgagtggcaaaaggtggaaattctccgccaggag 300

                                                                       
Query: 745 tcggagctgggccctcatcccagttctgattggattgttgactcaactgaaaatctacat 804
             |||||| | ||| ||||||| |||||||||||| |||||||||||||||||||| |||
Sbjct: 301 atggagctagccccacatcccaattctgattggatagttgactcaactgaaaatcttcat 360

                                    
Query: 805 gcagttgaattatctggtccaaggt 829
           |||||||| ||||||||||||||||
Sbjct: 361 gcagttgagttatctggtccaaggt 385


>gnl|LJGI|FS356573 homologue to UniRef100_A7L4A3 Cluster: Somatic embryogenesis
           receptor kinase; n=1; Carica papaya|Rep: Somatic
           embryogenesis receptor kinase - Carica papaya (Papaya),
           partial (12%)
          Length = 380

 Score =  450 bits (227), Expect = e-126
 Identities = 227/227 (100%)
 Strand = Plus / Minus

                                                                       
Query: 608 tccaggttgcactgctctgcacacaaggttccccaatggaacgaccaaagatgtcggaag 667
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 380 tccaggttgcactgctctgcacacaaggttccccaatggaacgaccaaagatgtcggaag 321

                                                                       
Query: 668 tggtgagaatgcttgaaggtgatggcttggcagaaagatgggatgagtggcagaaagtgg 727
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 tggtgagaatgcttgaaggtgatggcttggcagaaagatgggatgagtggcagaaagtgg 261

                                                                       
Query: 728 aagttctccgccaggaatcggagctgggccctcatcccagttctgattggattgttgact 787
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 260 aagttctccgccaggaatcggagctgggccctcatcccagttctgattggattgttgact 201

                                                          
Query: 788 caactgaaaatctacatgcagttgaattatctggtccaaggtgacca 834
           |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 200 caactgaaaatctacatgcagttgaattatctggtccaaggtgacca 154


>gnl|LJGI|TC68728 similar to UniRef100_A7L4A8 Cluster: Somatic embryogenesis receptor
            kinase; n=1; Carica papaya|Rep: Somatic embryogenesis
            receptor kinase - Carica papaya (Papaya), partial (80%)
          Length = 2038

 Score =  256 bits (129), Expect = 2e-67
 Identities = 444/549 (80%)
 Strand = Plus / Plus

                                                                        
Query: 176  tgggatcagcaaggggtctatcgtatttgcatgatcattgcgacccaaagattattcatc 235
            ||||||| || ||||| || || ||||||||||||||||| ||||| |||||||||||||
Sbjct: 957  tgggatctgccaggggactttcttatttgcatgatcattgtgacccgaagattattcatc 1016

                                                                        
Query: 236  gtgatgtgaaagctgcgaacatattgttggatgaggagtttgaggctgttgttggggact 295
            ||||||| || ||||| || ||||||||||||||| | ||||| || |||||||| || |
Sbjct: 1017 gtgatgtcaaggctgcaaatatattgttggatgagaaatttgaagcagttgttggagatt 1076

                                                                        
Query: 296  ttggtttggcaaaactaatggattacaaggacacccatgtgacaactgcagtacggggca 355
            |||||||||||||||| ||||||||||| || || ||||| || || || ||||| || |
Sbjct: 1077 ttggtttggcaaaacttatggattacaaagatactcatgttactaccgctgtacgcggta 1136

                                                                        
Query: 356  caatcgggcatatagctcccgagtacctatctactggtaaatcttcagagaaaactgacg 415
            | || ||||||||||| || |||||||| || ||||| || ||||| || || ||||| |
Sbjct: 1137 cgattgggcatatagcaccagagtacctgtcaactggaaagtcttccgaaaagactgatg 1196

                                                                        
Query: 416  tttttggttatggtatcatgcttctggagctgattactggacaaagagcttttgaccttg 475
            ||||||| || ||  | |||||||| || || || |||||||| || ||||| || || |
Sbjct: 1197 tttttggatacggagtgatgcttcttgaactaataactggacagagggctttcgatctag 1256

                                                                        
Query: 476  ctcggcttgcaaatgatgatgatgttatgctgcttgattgggtaaaaggtcttctgaaag 535
            | || ||||| ||||| |||||||| ||| |||| |||||||| ||||| ||||||||||
Sbjct: 1257 cacgtcttgccaatgacgatgatgtgatgttgctcgattgggttaaaggacttctgaaag 1316

                                                                        
Query: 536  agaaaaagcttgaaatgctggttgatcctgatctacaaaccaactatatagaagctgagg 595
            | || | | | ||||  ||||| ||| | ||| || |    || ||||| || |  ||||
Sbjct: 1317 acaagaggttggaaacactggtagatgcggatttagagggaaattatattgatgaggagg 1376

                                                                        
Query: 596  tagaacagttaatccaggttgcactgctctgcacacaaggttccccaatggaacgaccaa 655
            |||| ||||||||||| || ||  | || ||||||||||| ||||| |||||| ||||||
Sbjct: 1377 tagagcagttaatccaagtggccttactatgcacacaaggctcccctatggaaagaccaa 1436

                                                                        
Query: 656  agatgtcggaagtggtgagaatgcttgaaggtgatggcttggcagaaagatgggatgagt 715
            | ||||| || ||||| |||||||| ||||||||||| ||||| || | ||||||  | |
Sbjct: 1437 aaatgtctgaggtggttagaatgctagaaggtgatggtttggctgagaaatgggaccaat 1496

                     
Query: 716  ggcagaaag 724
            |||||||||
Sbjct: 1497 ggcagaaag 1505


>gnl|LJGI|AV410302 similar to UniRef100_Q94F62 Cluster: BRASSINOSTEROID INSENSITIVE
           1-associated receptor kinase 1 precursor; n=1;
           Arabidopsis thaliana|Rep: BRASSINOSTEROID INSENSITIVE
           1-associated receptor kinase 1 precursor - Arabidopsis
           thaliana (Mouse-ear cress), partial (18%)
          Length = 331

 Score = 71.9 bits (36), Expect = 6e-12
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                       
Query: 176 tgggatcagcaaggggtctatcgtatttgcatgatcattgcgacccaaagattattcatc 235
           ||||||| || ||||| || || |||||||||||| |||| ||||| |||||||||||||
Sbjct: 256 tgggatctgctaggggactttcttatttgcatgattattgtgacccgaagattattcatc 315

                           
Query: 236 gtgatgtgaaagctgc 251
           ||||||| || |||||
Sbjct: 316 gtgatgtcaaggctgc 331