Miyakogusa Predicted Gene
- Lj5g3v1875230.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v1875230.1 Non Chatacterized Hit- tr|I1NH81|I1NH81_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,97.83,0,PROTEIN_KINASE_DOM,Protein kinase, catalytic domain;
SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL,CUFF.56103.1
(834 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC68377 homologue to UniRef100_Q6BE26 Cluster: Somatic ... 462 e-129
gnl|LJGI|FS356573 homologue to UniRef100_A7L4A3 Cluster: Somatic... 450 e-126
gnl|LJGI|TC68728 similar to UniRef100_A7L4A8 Cluster: Somatic em... 256 2e-67
gnl|LJGI|AV410302 similar to UniRef100_Q94F62 Cluster: BRASSINOS... 72 6e-12
>gnl|LJGI|TC68377 homologue to UniRef100_Q6BE26 Cluster: Somatic embryogenesis
receptor kinase 1; n=1; Citrus unshiu|Rep: Somatic
embryogenesis receptor kinase 1 - Citrus unshiu (Satsuma
orange), partial (21%)
Length = 951
Score = 462 bits (233), Expect = e-129
Identities = 347/385 (90%)
Strand = Plus / Plus
Query: 445 ctgattactggacaaagagcttttgaccttgctcggcttgcaaatgatgatgatgttatg 504
||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 1 ctgatcactggacaaagagcgtttgacctagctcggcttgcaaatgatgatgatgttatg 60
Query: 505 ctgcttgattgggtaaaaggtcttctgaaagagaaaaagcttgaaatgctggttgatcct 564
||||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||
Sbjct: 61 ttgcttgactgggtaaaaggacttctgaaagagaaaaaactagaaatgctggttgatcct 120
Query: 565 gatctacaaaccaactatatagaagctgaggtagaacagttaatccaggttgcactgctc 624
||||| || | ||| || |||||||||||||||||||||||||||||||||||||| ||
Sbjct: 121 gatctccacaacaattacatagaagctgaggtagaacagttaatccaggttgcactcctt 180
Query: 625 tgcacacaaggttccccaatggaacgaccaaagatgtcggaagtggtgagaatgcttgaa 684
||||| ||||||||||| ||||| || || || ||||| || |||||| | |||||||||
Sbjct: 181 tgcactcaaggttcccctatggaccggcctaaaatgtcagaggtggtgcgtatgcttgaa 240
Query: 685 ggtgatggcttggcagaaagatgggatgagtggcagaaagtggaagttctccgccaggaa 744
||||||||||||||||||||||||||||||||||| || |||||| |||||||||||||
Sbjct: 241 ggtgatggcttggcagaaagatgggatgagtggcaaaaggtggaaattctccgccaggag 300
Query: 745 tcggagctgggccctcatcccagttctgattggattgttgactcaactgaaaatctacat 804
|||||| | ||| ||||||| |||||||||||| |||||||||||||||||||| |||
Sbjct: 301 atggagctagccccacatcccaattctgattggatagttgactcaactgaaaatcttcat 360
Query: 805 gcagttgaattatctggtccaaggt 829
|||||||| ||||||||||||||||
Sbjct: 361 gcagttgagttatctggtccaaggt 385
>gnl|LJGI|FS356573 homologue to UniRef100_A7L4A3 Cluster: Somatic embryogenesis
receptor kinase; n=1; Carica papaya|Rep: Somatic
embryogenesis receptor kinase - Carica papaya (Papaya),
partial (12%)
Length = 380
Score = 450 bits (227), Expect = e-126
Identities = 227/227 (100%)
Strand = Plus / Minus
Query: 608 tccaggttgcactgctctgcacacaaggttccccaatggaacgaccaaagatgtcggaag 667
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 380 tccaggttgcactgctctgcacacaaggttccccaatggaacgaccaaagatgtcggaag 321
Query: 668 tggtgagaatgcttgaaggtgatggcttggcagaaagatgggatgagtggcagaaagtgg 727
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 320 tggtgagaatgcttgaaggtgatggcttggcagaaagatgggatgagtggcagaaagtgg 261
Query: 728 aagttctccgccaggaatcggagctgggccctcatcccagttctgattggattgttgact 787
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 260 aagttctccgccaggaatcggagctgggccctcatcccagttctgattggattgttgact 201
Query: 788 caactgaaaatctacatgcagttgaattatctggtccaaggtgacca 834
|||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 200 caactgaaaatctacatgcagttgaattatctggtccaaggtgacca 154
>gnl|LJGI|TC68728 similar to UniRef100_A7L4A8 Cluster: Somatic embryogenesis receptor
kinase; n=1; Carica papaya|Rep: Somatic embryogenesis
receptor kinase - Carica papaya (Papaya), partial (80%)
Length = 2038
Score = 256 bits (129), Expect = 2e-67
Identities = 444/549 (80%)
Strand = Plus / Plus
Query: 176 tgggatcagcaaggggtctatcgtatttgcatgatcattgcgacccaaagattattcatc 235
||||||| || ||||| || || ||||||||||||||||| ||||| |||||||||||||
Sbjct: 957 tgggatctgccaggggactttcttatttgcatgatcattgtgacccgaagattattcatc 1016
Query: 236 gtgatgtgaaagctgcgaacatattgttggatgaggagtttgaggctgttgttggggact 295
||||||| || ||||| || ||||||||||||||| | ||||| || |||||||| || |
Sbjct: 1017 gtgatgtcaaggctgcaaatatattgttggatgagaaatttgaagcagttgttggagatt 1076
Query: 296 ttggtttggcaaaactaatggattacaaggacacccatgtgacaactgcagtacggggca 355
|||||||||||||||| ||||||||||| || || ||||| || || || ||||| || |
Sbjct: 1077 ttggtttggcaaaacttatggattacaaagatactcatgttactaccgctgtacgcggta 1136
Query: 356 caatcgggcatatagctcccgagtacctatctactggtaaatcttcagagaaaactgacg 415
| || ||||||||||| || |||||||| || ||||| || ||||| || || ||||| |
Sbjct: 1137 cgattgggcatatagcaccagagtacctgtcaactggaaagtcttccgaaaagactgatg 1196
Query: 416 tttttggttatggtatcatgcttctggagctgattactggacaaagagcttttgaccttg 475
||||||| || || | |||||||| || || || |||||||| || ||||| || || |
Sbjct: 1197 tttttggatacggagtgatgcttcttgaactaataactggacagagggctttcgatctag 1256
Query: 476 ctcggcttgcaaatgatgatgatgttatgctgcttgattgggtaaaaggtcttctgaaag 535
| || ||||| ||||| |||||||| ||| |||| |||||||| ||||| ||||||||||
Sbjct: 1257 cacgtcttgccaatgacgatgatgtgatgttgctcgattgggttaaaggacttctgaaag 1316
Query: 536 agaaaaagcttgaaatgctggttgatcctgatctacaaaccaactatatagaagctgagg 595
| || | | | |||| ||||| ||| | ||| || | || ||||| || | ||||
Sbjct: 1317 acaagaggttggaaacactggtagatgcggatttagagggaaattatattgatgaggagg 1376
Query: 596 tagaacagttaatccaggttgcactgctctgcacacaaggttccccaatggaacgaccaa 655
|||| ||||||||||| || || | || ||||||||||| ||||| |||||| ||||||
Sbjct: 1377 tagagcagttaatccaagtggccttactatgcacacaaggctcccctatggaaagaccaa 1436
Query: 656 agatgtcggaagtggtgagaatgcttgaaggtgatggcttggcagaaagatgggatgagt 715
| ||||| || ||||| |||||||| ||||||||||| ||||| || | |||||| | |
Sbjct: 1437 aaatgtctgaggtggttagaatgctagaaggtgatggtttggctgagaaatgggaccaat 1496
Query: 716 ggcagaaag 724
|||||||||
Sbjct: 1497 ggcagaaag 1505
>gnl|LJGI|AV410302 similar to UniRef100_Q94F62 Cluster: BRASSINOSTEROID INSENSITIVE
1-associated receptor kinase 1 precursor; n=1;
Arabidopsis thaliana|Rep: BRASSINOSTEROID INSENSITIVE
1-associated receptor kinase 1 precursor - Arabidopsis
thaliana (Mouse-ear cress), partial (18%)
Length = 331
Score = 71.9 bits (36), Expect = 6e-12
Identities = 66/76 (86%)
Strand = Plus / Plus
Query: 176 tgggatcagcaaggggtctatcgtatttgcatgatcattgcgacccaaagattattcatc 235
||||||| || ||||| || || |||||||||||| |||| ||||| |||||||||||||
Sbjct: 256 tgggatctgctaggggactttcttatttgcatgattattgtgacccgaagattattcatc 315
Query: 236 gtgatgtgaaagctgc 251
||||||| || |||||
Sbjct: 316 gtgatgtcaaggctgc 331