Miyakogusa Predicted Gene
- Lj5g3v1875170.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v1875170.1 Non Chatacterized Hit- tr|I1LD98|I1LD98_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.10649
PE,78.74,0,seg,NULL; no description,NULL; LRRNT_2,Leucine-rich
repeat-containing N-terminal, type 2; L domain-l,CUFF.56106.1
(702 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC67584 homologue to UniRef100_Q8GRK2 Cluster: Somatic ... 416 e-116
gnl|LJGI|TC59163 homologue to UniRef100_Q8GRK2 Cluster: Somatic ... 361 4e-99
gnl|LJGI|FS331996 homologue to UniRef100_Q8GRK2 Cluster: Somatic... 206 1e-52
gnl|LJGI|FS318779 homologue to UniRef100_Q8GRK2 Cluster: Somatic... 170 7e-42
gnl|LJGI|TC73326 homologue to UniRef100_A8KS50 Cluster: Somatic ... 70 2e-11
gnl|LJGI|AW720411 similar to UniRef100_Q94F62 Cluster: BRASSINOS... 64 1e-09
>gnl|LJGI|TC67584 homologue to UniRef100_Q8GRK2 Cluster: Somatic embryogenesis
receptor kinase 1; n=1; Medicago truncatula|Rep: Somatic
embryogenesis receptor kinase 1 - Medicago truncatula
(Barrel medic), partial (19%)
Length = 790
Score = 416 bits (210), Expect = e-116
Identities = 324/362 (89%)
Strand = Plus / Plus
Query: 1 atggagagaaagttgtgttctttagctttcatttggtgtgtcttgttggttaatccacta 60
|||||||||||||| ||| |||||||||| ||||||||||||||| ||||| ||||||||
Sbjct: 429 atggagagaaagttctgtgctttagcttttatttggtgtgtcttgctggttcatccacta 488
Query: 61 tggctgattgctgctaacaaggaaggtgatgttttacataggctgaggaaaaatttgaag 120
||||||||||||||||||| ||||||||||| |||||||| ||||||| |||||| |
Sbjct: 489 tggctgattgctgctaacatggaaggtgatgcattacatagcctgaggacaaatttacaa 548
Query: 121 gatccttacaatgttctgcaaagttgggaccctaaacttgccaatccatgcacatggttt 180
|||||| |||||||| ||||||||||||| |||| ||||| |||||||||||||||||||
Sbjct: 549 gatcctaacaatgttttgcaaagttgggatcctacacttgtcaatccatgcacatggttt 608
Query: 181 catgtaacatgcaacggtgataatagtgtcgtaagagttgatctaggagatgctgctttg 240
||||||||||||||| |||||| |||||| ||||||||||| | ||| |||||||||||
Sbjct: 609 catgtaacatgcaacaatgataacagtgtcataagagttgatttgggaaatgctgctttg 668
Query: 241 tctggtcgacttgttccccagcttggtcaactcaagaatttgcagtatttggaacttttc 300
||||||| ||||||| | |||||||| ||||||||||||||||||||||||||||||| |
Sbjct: 669 tctggtcaacttgtttcacagcttggccaactcaagaatttgcagtatttggaactttac 728
Query: 301 aacaatagcataagaggccctattccaagtgacctggggaaacttactaacctggtaagc 360
| ||||| ||| | ||||| |||||||||||||||||||| |||||||||||||| |||
Sbjct: 729 agcaataacattaccggcccaattccaagtgacctggggaatcttactaacctggtgagc 788
Query: 361 tt 362
||
Sbjct: 789 tt 790
>gnl|LJGI|TC59163 homologue to UniRef100_Q8GRK2 Cluster: Somatic embryogenesis
receptor kinase 1; n=1; Medicago truncatula|Rep: Somatic
embryogenesis receptor kinase 1 - Medicago truncatula
(Barrel medic), partial (25%)
Length = 852
Score = 361 bits (182), Expect = 4e-99
Identities = 398/470 (84%)
Strand = Plus / Plus
Query: 61 tggctgattgctgctaacaaggaaggtgatgttttacataggctgaggaaaaatttgaag 120
||||| ||| ||||||||| |||||| |||| |||||| | || |||| |||||| |
Sbjct: 383 tggctcatttctgctaacatggaaggggatgcattacatggcctcaggacaaatttacaa 442
Query: 121 gatccttacaatgttctgcaaagttgggaccctaaacttgccaatccatgcacatggttt 180
|| ||| |||||||| |||||||||||||||||| ||| | ||||||||| || ||||||
Sbjct: 443 gaccctaacaatgttttgcaaagttgggaccctacactggtcaatccatgtacgtggttt 502
Query: 181 catgtaacatgcaacggtgataatagtgtcgtaagagttgatctaggagatgctgctttg 240
||||||||||||||| ||||||||||||| ||||||||||||| ||| |||||||| |
Sbjct: 503 catgtaacatgcaacaatgataatagtgtcataagagttgatctgggaaatgctgctcta 562
Query: 241 tctggtcgacttgttccccagcttggtcaactcaagaatttgcagtatttggaacttttc 300
||||||| ||||||||| |||||||| ||||||||||| || |||||||||||||| | |
Sbjct: 563 tctggtcaacttgttcctcagcttggccaactcaagaacttacagtatttggaactctac 622
Query: 301 aacaatagcataagaggccctattccaagtgacctggggaaacttactaacctggtaagc 360
| ||||| ||| || || || |||||||||||| ||||||| ||||||| | |||| |||
Sbjct: 623 agcaataacattagtggtccaattccaagtgacttggggaatcttactagcttggtgagc 682
Query: 361 ttggatttgtacctaaaccgtttctctggccctatcccagattcattgggcaagttgtca 420
|||||| |||||||||||| |||| ||| |||||||| ||||||||||||||| | ||
Sbjct: 683 ttggatctgtacctaaaccatttcagtggtcctatccctgattcattgggcaagctatcc 742
Query: 421 aagttgcgtttcctccggcttaacaacaatagactgagtggtcatattcccatgacactg 480
|| |||||||||||||||||||| || || || ||| |||| |||||||||| ||||
Sbjct: 743 aaattgcgtttcctccggcttaataataacagcttgacgggtcctattcccatgccacta 802
Query: 481 acaaatattgatactctccaagttctggatttgtctaataaccgtctctc 530
|| |||||| |||||||||| ||||||||||||||||||||||||||
Sbjct: 803 actaatatttcagctctccaagtgctggatttgtctaataaccgtctctc 852
>gnl|LJGI|FS331996 homologue to UniRef100_Q8GRK2 Cluster: Somatic embryogenesis
receptor kinase 1; n=1; Medicago truncatula|Rep: Somatic
embryogenesis receptor kinase 1 - Medicago truncatula
(Barrel medic), partial (14%)
Length = 690
Score = 206 bits (104), Expect = 1e-52
Identities = 203/236 (86%)
Strand = Plus / Plus
Query: 61 tggctgattgctgctaacaaggaaggtgatgttttacataggctgaggaaaaatttgaag 120
||||| ||| ||||||||| |||||| |||| |||||| | || |||| |||||| |
Sbjct: 428 tggctcatttctgctaacatggaaggggatgcattacatggcctcaggacaaatttacaa 487
Query: 121 gatccttacaatgttctgcaaagttgggaccctaaacttgccaatccatgcacatggttt 180
|| ||| |||||||| |||||||||||||||||| ||| | ||||||||| || ||||||
Sbjct: 488 gaccctaacaatgttttgcaaagttgggaccctacactggtcaatccatgtacgtggttt 547
Query: 181 catgtaacatgcaacggtgataatagtgtcgtaagagttgatctaggagatgctgctttg 240
||||||||||||||| ||||||||||||| ||||||||||||| ||| |||||||| |
Sbjct: 548 catgtaacatgcaacaatgataatagtgtcataagagttgatctgggaaatgctgctcta 607
Query: 241 tctggtcgacttgttccccagcttggtcaactcaagaatttgcagtatttggaact 296
||||||| ||||||||| |||||||| ||||||||||| || ||||||||||||||
Sbjct: 608 tctggtcaacttgttcctcagcttggccaactcaagaacttacagtatttggaact 663
>gnl|LJGI|FS318779 homologue to UniRef100_Q8GRK2 Cluster: Somatic embryogenesis
receptor kinase 1; n=1; Medicago truncatula|Rep: Somatic
embryogenesis receptor kinase 1 - Medicago truncatula
(Barrel medic), partial (17%)
Length = 745
Score = 170 bits (86), Expect = 7e-42
Identities = 182/214 (85%)
Strand = Plus / Plus
Query: 218 ttgatctaggagatgctgctttgtctggtcgacttgttccccagcttggtcaactcaaga 277
||||||| ||| |||||||| | ||||||| ||||||||| |||||||| ||||||||||
Sbjct: 532 ttgatctgggaaatgctgctctatctggtcaacttgttcctcagcttggccaactcaaga 591
Query: 278 atttgcagtatttggaacttttcaacaatagcataagaggccctattccaagtgacctgg 337
| || |||||||||||||| | || ||||| ||| || || || |||||||||||| |||
Sbjct: 592 acttacagtatttggaactctacagcaataacattagtggtccaattccaagtgacttgg 651
Query: 338 ggaaacttactaacctggtaagcttggatttgtacctaaaccgtttctctggccctatcc 397
|||| ||||||| | |||| ||||||||| |||||||||||| |||| ||| |||||||
Sbjct: 652 ggaatcttactagcttggtgagcttggatctgtacctaaaccatttcagtggtcctatcc 711
Query: 398 cagattcattgggcaagttgtcaaagttgcgttt 431
| ||||||||||||||| | || || ||||||||
Sbjct: 712 ctgattcattgggcaagctatccaaattgcgttt 745
Score = 65.9 bits (33), Expect = 3e-10
Identities = 90/109 (82%)
Strand = Plus / Plus
Query: 61 tggctgattgctgctaacaaggaaggtgatgttttacataggctgaggaaaaatttgaag 120
||||| ||| ||||||||| |||||| |||| |||||| | || |||| |||||| |
Sbjct: 424 tggctcatttctgctaacatggaaggggatgcattacatggcctcaggacaaatttacaa 483
Query: 121 gatccttacaatgttctgcaaagttgggaccctaaacttgccaatccat 169
|| ||| |||||||| |||||||||||||||||| ||| | ||||||||
Sbjct: 484 gaccctaacaatgttttgcaaagttgggaccctacactggtcaatccat 532
>gnl|LJGI|TC73326 homologue to UniRef100_A8KS50 Cluster: Somatic embryogenesis
receptor kinase; n=1; Capsicum chinense|Rep: Somatic
embryogenesis receptor kinase - Capsicum chinense
(Scotch bonnet) (Bonnet pepper), partial (52%)
Length = 488
Score = 69.9 bits (35), Expect = 2e-11
Identities = 72/83 (86%), Gaps = 1/83 (1%)
Strand = Plus / Plus
Query: 545 ataatggttccttcgcattattcactcctataagttttgc-aaacaacttggatctgtgt 603
||||||| |||||| |||||||||||||||| |||||| | || ||||||||||| |||
Sbjct: 6 ataatggctccttctcattattcactcctatcagttttactcaataacttggatctatgt 65
Query: 604 ggaccagtcactgggaacccttg 626
|| || ||||||||| |||||||
Sbjct: 66 ggccctgtcactgggcacccttg 88
>gnl|LJGI|AW720411 similar to UniRef100_Q94F62 Cluster: BRASSINOSTEROID INSENSITIVE
1-associated receptor kinase 1 precursor; n=1;
Arabidopsis thaliana|Rep: BRASSINOSTEROID INSENSITIVE
1-associated receptor kinase 1 precursor - Arabidopsis
thaliana (Mouse-ear cress), partial (8%)
Length = 574
Score = 63.9 bits (32), Expect = 1e-09
Identities = 65/76 (85%)
Strand = Plus / Plus
Query: 115 ttgaaggatccttacaatgttctgcaaagttgggaccctaaacttgccaatccatgcaca 174
||||| |||||| |||| ||||| ||||||||||| ||| |||| |||||| ||||||
Sbjct: 499 ttgaatgatcctaacaacgttcttcaaagttgggatgctacccttgtcaatccctgcaca 558
Query: 175 tggtttcatgtaacat 190
||||||||||| ||||
Sbjct: 559 tggtttcatgttacat 574