Miyakogusa Predicted Gene

Lj5g3v1875170.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1875170.1 Non Chatacterized Hit- tr|I1LD98|I1LD98_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.10649
PE,78.74,0,seg,NULL; no description,NULL; LRRNT_2,Leucine-rich
repeat-containing N-terminal, type 2; L domain-l,CUFF.56106.1
         (702 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67584 homologue to UniRef100_Q8GRK2 Cluster: Somatic ...   416   e-116
gnl|LJGI|TC59163 homologue to UniRef100_Q8GRK2 Cluster: Somatic ...   361   4e-99
gnl|LJGI|FS331996 homologue to UniRef100_Q8GRK2 Cluster: Somatic...   206   1e-52
gnl|LJGI|FS318779 homologue to UniRef100_Q8GRK2 Cluster: Somatic...   170   7e-42
gnl|LJGI|TC73326 homologue to UniRef100_A8KS50 Cluster: Somatic ...    70   2e-11
gnl|LJGI|AW720411 similar to UniRef100_Q94F62 Cluster: BRASSINOS...    64   1e-09

>gnl|LJGI|TC67584 homologue to UniRef100_Q8GRK2 Cluster: Somatic embryogenesis
           receptor kinase 1; n=1; Medicago truncatula|Rep: Somatic
           embryogenesis receptor kinase 1 - Medicago truncatula
           (Barrel medic), partial (19%)
          Length = 790

 Score =  416 bits (210), Expect = e-116
 Identities = 324/362 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggagagaaagttgtgttctttagctttcatttggtgtgtcttgttggttaatccacta 60
           |||||||||||||| ||| |||||||||| ||||||||||||||| ||||| ||||||||
Sbjct: 429 atggagagaaagttctgtgctttagcttttatttggtgtgtcttgctggttcatccacta 488

                                                                       
Query: 61  tggctgattgctgctaacaaggaaggtgatgttttacataggctgaggaaaaatttgaag 120
           ||||||||||||||||||| |||||||||||  |||||||| ||||||| ||||||  | 
Sbjct: 489 tggctgattgctgctaacatggaaggtgatgcattacatagcctgaggacaaatttacaa 548

                                                                       
Query: 121 gatccttacaatgttctgcaaagttgggaccctaaacttgccaatccatgcacatggttt 180
           |||||| |||||||| ||||||||||||| |||| ||||| |||||||||||||||||||
Sbjct: 549 gatcctaacaatgttttgcaaagttgggatcctacacttgtcaatccatgcacatggttt 608

                                                                       
Query: 181 catgtaacatgcaacggtgataatagtgtcgtaagagttgatctaggagatgctgctttg 240
           |||||||||||||||  |||||| |||||| ||||||||||| | ||| |||||||||||
Sbjct: 609 catgtaacatgcaacaatgataacagtgtcataagagttgatttgggaaatgctgctttg 668

                                                                       
Query: 241 tctggtcgacttgttccccagcttggtcaactcaagaatttgcagtatttggaacttttc 300
           ||||||| ||||||| | |||||||| ||||||||||||||||||||||||||||||| |
Sbjct: 669 tctggtcaacttgtttcacagcttggccaactcaagaatttgcagtatttggaactttac 728

                                                                       
Query: 301 aacaatagcataagaggccctattccaagtgacctggggaaacttactaacctggtaagc 360
           | ||||| ||| |  ||||| |||||||||||||||||||| |||||||||||||| |||
Sbjct: 729 agcaataacattaccggcccaattccaagtgacctggggaatcttactaacctggtgagc 788

             
Query: 361 tt 362
           ||
Sbjct: 789 tt 790


>gnl|LJGI|TC59163 homologue to UniRef100_Q8GRK2 Cluster: Somatic embryogenesis
           receptor kinase 1; n=1; Medicago truncatula|Rep: Somatic
           embryogenesis receptor kinase 1 - Medicago truncatula
           (Barrel medic), partial (25%)
          Length = 852

 Score =  361 bits (182), Expect = 4e-99
 Identities = 398/470 (84%)
 Strand = Plus / Plus

                                                                       
Query: 61  tggctgattgctgctaacaaggaaggtgatgttttacataggctgaggaaaaatttgaag 120
           ||||| ||| ||||||||| |||||| ||||  |||||| | || |||| ||||||  | 
Sbjct: 383 tggctcatttctgctaacatggaaggggatgcattacatggcctcaggacaaatttacaa 442

                                                                       
Query: 121 gatccttacaatgttctgcaaagttgggaccctaaacttgccaatccatgcacatggttt 180
           || ||| |||||||| |||||||||||||||||| ||| | ||||||||| || ||||||
Sbjct: 443 gaccctaacaatgttttgcaaagttgggaccctacactggtcaatccatgtacgtggttt 502

                                                                       
Query: 181 catgtaacatgcaacggtgataatagtgtcgtaagagttgatctaggagatgctgctttg 240
           |||||||||||||||  ||||||||||||| ||||||||||||| ||| |||||||| | 
Sbjct: 503 catgtaacatgcaacaatgataatagtgtcataagagttgatctgggaaatgctgctcta 562

                                                                       
Query: 241 tctggtcgacttgttccccagcttggtcaactcaagaatttgcagtatttggaacttttc 300
           ||||||| ||||||||| |||||||| ||||||||||| || |||||||||||||| | |
Sbjct: 563 tctggtcaacttgttcctcagcttggccaactcaagaacttacagtatttggaactctac 622

                                                                       
Query: 301 aacaatagcataagaggccctattccaagtgacctggggaaacttactaacctggtaagc 360
           | ||||| ||| || || || |||||||||||| ||||||| ||||||| | |||| |||
Sbjct: 623 agcaataacattagtggtccaattccaagtgacttggggaatcttactagcttggtgagc 682

                                                                       
Query: 361 ttggatttgtacctaaaccgtttctctggccctatcccagattcattgggcaagttgtca 420
           |||||| |||||||||||| ||||  ||| |||||||| ||||||||||||||| | || 
Sbjct: 683 ttggatctgtacctaaaccatttcagtggtcctatccctgattcattgggcaagctatcc 742

                                                                       
Query: 421 aagttgcgtttcctccggcttaacaacaatagactgagtggtcatattcccatgacactg 480
           || |||||||||||||||||||| || || ||  |||  |||| |||||||||| |||| 
Sbjct: 743 aaattgcgtttcctccggcttaataataacagcttgacgggtcctattcccatgccacta 802

                                                             
Query: 481 acaaatattgatactctccaagttctggatttgtctaataaccgtctctc 530
           || ||||||    |||||||||| ||||||||||||||||||||||||||
Sbjct: 803 actaatatttcagctctccaagtgctggatttgtctaataaccgtctctc 852


>gnl|LJGI|FS331996 homologue to UniRef100_Q8GRK2 Cluster: Somatic embryogenesis
           receptor kinase 1; n=1; Medicago truncatula|Rep: Somatic
           embryogenesis receptor kinase 1 - Medicago truncatula
           (Barrel medic), partial (14%)
          Length = 690

 Score =  206 bits (104), Expect = 1e-52
 Identities = 203/236 (86%)
 Strand = Plus / Plus

                                                                       
Query: 61  tggctgattgctgctaacaaggaaggtgatgttttacataggctgaggaaaaatttgaag 120
           ||||| ||| ||||||||| |||||| ||||  |||||| | || |||| ||||||  | 
Sbjct: 428 tggctcatttctgctaacatggaaggggatgcattacatggcctcaggacaaatttacaa 487

                                                                       
Query: 121 gatccttacaatgttctgcaaagttgggaccctaaacttgccaatccatgcacatggttt 180
           || ||| |||||||| |||||||||||||||||| ||| | ||||||||| || ||||||
Sbjct: 488 gaccctaacaatgttttgcaaagttgggaccctacactggtcaatccatgtacgtggttt 547

                                                                       
Query: 181 catgtaacatgcaacggtgataatagtgtcgtaagagttgatctaggagatgctgctttg 240
           |||||||||||||||  ||||||||||||| ||||||||||||| ||| |||||||| | 
Sbjct: 548 catgtaacatgcaacaatgataatagtgtcataagagttgatctgggaaatgctgctcta 607

                                                                   
Query: 241 tctggtcgacttgttccccagcttggtcaactcaagaatttgcagtatttggaact 296
           ||||||| ||||||||| |||||||| ||||||||||| || ||||||||||||||
Sbjct: 608 tctggtcaacttgttcctcagcttggccaactcaagaacttacagtatttggaact 663


>gnl|LJGI|FS318779 homologue to UniRef100_Q8GRK2 Cluster: Somatic embryogenesis
           receptor kinase 1; n=1; Medicago truncatula|Rep: Somatic
           embryogenesis receptor kinase 1 - Medicago truncatula
           (Barrel medic), partial (17%)
          Length = 745

 Score =  170 bits (86), Expect = 7e-42
 Identities = 182/214 (85%)
 Strand = Plus / Plus

                                                                       
Query: 218 ttgatctaggagatgctgctttgtctggtcgacttgttccccagcttggtcaactcaaga 277
           ||||||| ||| |||||||| | ||||||| ||||||||| |||||||| ||||||||||
Sbjct: 532 ttgatctgggaaatgctgctctatctggtcaacttgttcctcagcttggccaactcaaga 591

                                                                       
Query: 278 atttgcagtatttggaacttttcaacaatagcataagaggccctattccaagtgacctgg 337
           | || |||||||||||||| | || ||||| ||| || || || |||||||||||| |||
Sbjct: 592 acttacagtatttggaactctacagcaataacattagtggtccaattccaagtgacttgg 651

                                                                       
Query: 338 ggaaacttactaacctggtaagcttggatttgtacctaaaccgtttctctggccctatcc 397
           |||| ||||||| | |||| ||||||||| |||||||||||| ||||  ||| |||||||
Sbjct: 652 ggaatcttactagcttggtgagcttggatctgtacctaaaccatttcagtggtcctatcc 711

                                             
Query: 398 cagattcattgggcaagttgtcaaagttgcgttt 431
           | ||||||||||||||| | || || ||||||||
Sbjct: 712 ctgattcattgggcaagctatccaaattgcgttt 745



 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 61  tggctgattgctgctaacaaggaaggtgatgttttacataggctgaggaaaaatttgaag 120
           ||||| ||| ||||||||| |||||| ||||  |||||| | || |||| ||||||  | 
Sbjct: 424 tggctcatttctgctaacatggaaggggatgcattacatggcctcaggacaaatttacaa 483

                                                            
Query: 121 gatccttacaatgttctgcaaagttgggaccctaaacttgccaatccat 169
           || ||| |||||||| |||||||||||||||||| ||| | ||||||||
Sbjct: 484 gaccctaacaatgttttgcaaagttgggaccctacactggtcaatccat 532


>gnl|LJGI|TC73326 homologue to UniRef100_A8KS50 Cluster: Somatic embryogenesis
           receptor kinase; n=1; Capsicum chinense|Rep: Somatic
           embryogenesis receptor kinase - Capsicum chinense
           (Scotch bonnet) (Bonnet pepper), partial (52%)
          Length = 488

 Score = 69.9 bits (35), Expect = 2e-11
 Identities = 72/83 (86%), Gaps = 1/83 (1%)
 Strand = Plus / Plus

                                                                       
Query: 545 ataatggttccttcgcattattcactcctataagttttgc-aaacaacttggatctgtgt 603
           ||||||| |||||| |||||||||||||||| |||||| |  || ||||||||||| |||
Sbjct: 6   ataatggctccttctcattattcactcctatcagttttactcaataacttggatctatgt 65

                                  
Query: 604 ggaccagtcactgggaacccttg 626
           || || ||||||||| |||||||
Sbjct: 66  ggccctgtcactgggcacccttg 88


>gnl|LJGI|AW720411 similar to UniRef100_Q94F62 Cluster: BRASSINOSTEROID INSENSITIVE
           1-associated receptor kinase 1 precursor; n=1;
           Arabidopsis thaliana|Rep: BRASSINOSTEROID INSENSITIVE
           1-associated receptor kinase 1 precursor - Arabidopsis
           thaliana (Mouse-ear cress), partial (8%)
          Length = 574

 Score = 63.9 bits (32), Expect = 1e-09
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 115 ttgaaggatccttacaatgttctgcaaagttgggaccctaaacttgccaatccatgcaca 174
           ||||| |||||| |||| ||||| |||||||||||  |||  |||| |||||| ||||||
Sbjct: 499 ttgaatgatcctaacaacgttcttcaaagttgggatgctacccttgtcaatccctgcaca 558

                           
Query: 175 tggtttcatgtaacat 190
           ||||||||||| ||||
Sbjct: 559 tggtttcatgttacat 574