Miyakogusa Predicted Gene

Lj5g3v1698870.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1698870.1 Non Chatacterized Hit- tr|I1LCL8|I1LCL8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.5460 PE=,84.46,0,no
description,Immunoglobulin-like fold; no description,Glycoside
hydrolase, catalytic domain; PULLU,CUFF.55789.1
         (2817 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP029460 similar to UniRef100_Q0JF44 Cluster: Os04g0164...    62   2e-08

>gnl|LJGI|BP029460 similar to UniRef100_Q0JF44 Cluster: Os04g0164900 protein; n=1; Oryza
            sativa Japonica Group|Rep: Os04g0164900 protein - Oryza
            sativa subsp. japonica (Rice), partial (4%)
          Length = 416

 Score = 61.9 bits (31), Expect = 2e-08
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                           
Query: 2787 gagctcaacatacgaggcatcctctggctgt 2817
            |||||||||||||||||||||||||||||||
Sbjct: 416  gagctcaacatacgaggcatcctctggctgt 386