Miyakogusa Predicted Gene

Lj5g3v1695660.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1695660.1 Non Chatacterized Hit- tr|I1JFD8|I1JFD8_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,63.31,0,INHIBITOR OF APOPTOSIS,NULL; no description,Zinc finger,
RING/FYVE/PHD-type; coiled-coil,NULL; seg,N,CUFF.55708.1
         (2487 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC600042 similar to UniRef100_UPI00015A807A Cluster: VI...   212   8e-54
gnl|LJGI|BP084558                                                     123   6e-27

>gnl|LJGI|DC600042 similar to UniRef100_UPI00015A807A Cluster: VIP36-like protein
           precursor (Lectin, mannose-binding 2-like) (LMAN2- like
           protein).; n=1; Danio rerio|Rep: VIP36-like protein
           precursor (Lectin, mannose-binding 2-like) (LMAN2- like
           protein). - Danio rerio, partial (5%)
          Length = 323

 Score =  212 bits (107), Expect = 8e-54
 Identities = 113/115 (98%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggcaaaggtgtgttgggctttagtgtagttgttccggatatgggcaatactgttgat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 209 atgggcaaaggtgtgttgggctttagtgtagttgttccggatatgggcaatactgttgat 268

                                                                  
Query: 61  ggtgaggaagggcatgatcaagggtgtaagaacaagagaaaattagctcatccat 115
           ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||
Sbjct: 269 ggtgaggaagggcatgatcaagggtgtaagaacaagaaaaaattaactcatccat 323


>gnl|LJGI|BP084558 
          Length = 351

 Score =  123 bits (62), Expect = 6e-27
 Identities = 62/62 (100%)
 Strand = Plus / Minus

                                                                        
Query: 2426 aatgcccttcatgcagggctccaatccaacacagggttcatgctagatttgctgggcaat 2485
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351  aatgcccttcatgcagggctccaatccaacacagggttcatgctagatttgctgggcaat 292

              
Query: 2486 aa 2487
            ||
Sbjct: 291  aa 290