Miyakogusa Predicted Gene

Lj5g3v1670370.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1670370.1 tr|B6SR01|B6SR01_MAIZE Heme-binding protein 2
OS=Zea mays PE=2 SV=1,66.2,2e-19,HEME-BINDING PROTEIN-RELATED,NULL;
HEME-BINDING PROTEIN-RELATED,SOUL haem-binding protein; Probable
,CUFF.55688.1
         (285 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64512 weakly similar to UniRef100_A9XNN2 Cluster: SOU...   557   e-158

>gnl|LJGI|TC64512 weakly similar to UniRef100_A9XNN2 Cluster: SOUL-like protein; n=2;
           Sonneratia|Rep: SOUL-like protein - Sonneratia
           caseolaris, partial (83%)
          Length = 780

 Score =  557 bits (281), Expect = e-158
 Identities = 284/285 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaagaagaacgggacactgatcgtggcggttaacttgatgtgtttggtcatggttcac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14  atgaagaagaacgggacactgatcgtggcggttaacttgatgtgtttggtcatggttcac 73

                                                                       
Query: 61  tgtacgccggaaaccccgtcgtacacggtggtccactccgactccgatttcgagatcaga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 74  tgtacgccggaaaccccgtcgtacacggtggtccactccgactccgatttcgagatcaga 133

                                                                       
Query: 121 ctctaccggagctccgtctggatgtccgcccccgccgttgacataatctccttcgagaaa 180
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 134 ctctaccggagctccgtctggatgtccgctcccgccgttgacataatctccttcgagaaa 193

                                                                       
Query: 181 gccacctggaatggcttccacagattgttccagttcacacaaggtgccaacctcaatttc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 194 gccacctggaatggcttccacagattgttccagttcacacaaggtgccaacctcaatttc 253

                                                        
Query: 241 tctcggattccgatgactattccaattttgacaaccctggtcgcc 285
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 254 tctcggattccgatgactattccaattttgacaaccctggtcgcc 298