Miyakogusa Predicted Gene

Lj5g3v1664170.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1664170.1 Non Chatacterized Hit- tr|I1L7X1|I1L7X1_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.7672
PE=,81.63,0,Cation_efflux,Cation efflux protein; CDF: cation diffusion
facilitator family transport,Cation efflu,CUFF.55671.1
         (1014 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82686                                                       94   2e-18

>gnl|LJGI|TC82686 
          Length = 1407

 Score = 93.7 bits (47), Expect = 2e-18
 Identities = 65/71 (91%)
 Strand = Plus / Minus

                                                                        
Query: 942  tgtctccagtgtagttcatgttgggatccaactacgtttagggcaaccatttccagggat 1001
            |||||||| |||||||||||||||||| || |||||||| ||| ||||||||||||||||
Sbjct: 1358 tgtctccaatgtagttcatgttgggattcagctacgtttggggaaaccatttccagggat 1299

                       
Query: 1002 caatcactctt 1012
            |||||| ||||
Sbjct: 1298 caatcattctt 1288



 Score = 87.7 bits (44), Expect = 1e-16
 Identities = 44/44 (100%)
 Strand = Plus / Minus

                                                        
Query: 971  aactacgtttagggcaaccatttccagggatcaatcactcttag 1014
            ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1407 aactacgtttagggcaaccatttccagggatcaatcactcttag 1364