Miyakogusa Predicted Gene

Lj5g3v1605690.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1605690.1 Non Chatacterized Hit- tr|F6HYJ1|F6HYJ1_VITVI
Putative uncharacterized protein OS=Vitis vinifera GN=,66.67,0.0004,
,CUFF.55627.1
         (326 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81259 similar to UniRef100_Q08DX4 Cluster: Wiskott-Al...   206   6e-53
gnl|LJGI|DC593478 similar to UniRef100_Q944P7 Cluster: Leucine a...   107   4e-23

>gnl|LJGI|TC81259 similar to UniRef100_Q08DX4 Cluster: Wiskott-Aldrich syndrome
           protein interacting protein; n=1; Bos taurus|Rep:
           Wiskott-Aldrich syndrome protein interacting protein -
           Bos taurus (Bovine), partial (4%)
          Length = 886

 Score =  206 bits (104), Expect = 6e-53
 Identities = 123/132 (93%)
 Strand = Plus / Plus

                                                                       
Query: 195 catcctcaactcgctcgactccaaattgaacggtctcttggctgaagcctcttccgaaga 254
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 726 catcctcaactcgctcgactccaaattgaacggtctcttggttgaagcctcttccgaaga 785

                                                                       
Query: 255 aaatccggccagtccacggttcannnnnnnncaccagagaccttcacactcaattgtgct 314
           |||||||||||||||||||||||        |||||||||||||||||||||||||||||
Sbjct: 786 aaatccggccagtccacggttcattttttttcaccagagaccttcacactcaattgtgct 845

                       
Query: 315 tttacgatgaga 326
           ||||||||||||
Sbjct: 846 tttacgatgaga 857


>gnl|LJGI|DC593478 similar to UniRef100_Q944P7 Cluster: Leucine aminopeptidase 3,
           chloroplast precursor; n=2; Arabidopsis thaliana|Rep:
           Leucine aminopeptidase 3, chloroplast precursor -
           Arabidopsis thaliana (Mouse-ear cress), partial (18%)
          Length = 566

 Score =  107 bits (54), Expect = 4e-23
 Identities = 60/62 (96%)
 Strand = Plus / Plus

                                                                       
Query: 194 ccatcctcaactcgctcgactccaaattgaacggtctcttggctgaagcctcttccgaag 253
           |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 159 ccatcctcaagtcgctcgactccaaattgaacggtctcttggctgaagcatcttccgaag 218

             
Query: 254 aa 255
           ||
Sbjct: 219 aa 220



 Score = 50.1 bits (25), Expect = 8e-06
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 127 cccaccaccaccgaaacccccaacc 151
           |||||||||||||||||||||||||
Sbjct: 65  cccaccaccaccgaaacccccaacc 89