Miyakogusa Predicted Gene

Lj5g3v1601870.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1601870.1 Non Chatacterized Hit- tr|I1JQQ4|I1JQQ4_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,62.79,4e-18,DUF761,Protein of unknown function DUF761, plant;
seg,NULL,CUFF.55591.1
         (634 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72905 weakly similar to UniRef100_A7QCA8 Cluster: Chr...    78   7e-14

>gnl|LJGI|TC72905 weakly similar to UniRef100_A7QCA8 Cluster: Chromosome undetermined
           scaffold_77, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_77, whole
           genome shotgun sequence - Vitis vinifera (Grape),
           partial (19%)
          Length = 1014

 Score = 77.8 bits (39), Expect = 7e-14
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 516 gattgatgccaaagctgaggattttattgctcagttttaccagcaaatgaggttgcagag 575
           |||||||| ||| |||||||| ||||||||||| || ||||||||||||| ||||||| |
Sbjct: 598 gattgatgacaaggctgaggaatttattgctcaattctaccagcaaatgaagttgcagcg 657

                                                                      
Query: 576 gttggatgtggtggatagtcgttacaatgagataagtcagaggtcattagggttatgat 634
            ||||||     |||| |||||||||| |||  |||| |||| ||||||||| ||||||
Sbjct: 658 cttggattctacggatcgtcgttacaacgagcgaagtgagagatcattaggggtatgat 716