Miyakogusa Predicted Gene

Lj5g3v1601830.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1601830.1 CUFF.55585.1
         (786 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO011660                                                      52   5e-06
gnl|LJGI|TC70393 homologue to UniRef100_A9VBY1 Cluster: Predicte...    52   5e-06

>gnl|LJGI|GO011660 
          Length = 616

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 28  tcagcctcagcctcagcctcagcctc 53
           ||||||||||||||||||||||||||
Sbjct: 140 tcagcctcagcctcagcctcagcctc 165



 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 28  tcagcctcagcctcagcctcagcctc 53
           ||||||||||||||||||||||||||
Sbjct: 146 tcagcctcagcctcagcctcagcctc 171



 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 28  tcagcctcagcctcagcctcagcctc 53
           ||||||||||||||||||||||||||
Sbjct: 152 tcagcctcagcctcagcctcagcctc 177


>gnl|LJGI|TC70393 homologue to UniRef100_A9VBY1 Cluster: Predicted protein; n=1;
           Monosiga brevicollis MX1|Rep: Predicted protein -
           Monosiga brevicollis MX1, partial (13%)
          Length = 940

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 28  tcagcctcagcctcagcctcagcctc 53
           ||||||||||||||||||||||||||
Sbjct: 209 tcagcctcagcctcagcctcagcctc 234