Miyakogusa Predicted Gene
- Lj5g3v1533360.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v1533360.1 Non Chatacterized Hit- tr|I1NET4|I1NET4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.28592
PE,65.01,0,HTH_MYB,Myb domain; SANT SWI3, ADA2, N-CoR and TFIIIB''
DNA-bin,SANT/Myb domain; seg,NULL; no descr,CUFF.55443.1
(1224 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB tra... 696 0.0
gnl|LJGI|FS328706 similar to UniRef100_A7Q0Y1 Cluster: Chromosom... 186 2e-46
gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromos... 96 6e-19
gnl|LJGI|AV776018 similar to UniRef100_Q0PJD4 Cluster: MYB trans... 68 1e-10
gnl|LJGI|TC78802 similar to UniRef100_A7Q8B3 Cluster: Chromosome... 68 1e-10
gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 ... 54 2e-06
gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n... 52 8e-06
>gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB transcription factor
MYB160; n=1; Glycine max|Rep: MYB transcription factor
MYB160 - Glycine max (Soybean), partial (60%)
Length = 351
Score = 696 bits (351), Expect = 0.0
Identities = 351/351 (100%)
Strand = Plus / Plus
Query: 29 agaagctacgcaaaggtctctggtctccagaggaagatgaaaagctcttgaatcacatca 88
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 agaagctacgcaaaggtctctggtctccagaggaagatgaaaagctcttgaatcacatca 60
Query: 89 ccaaacatggccatggatgctggagctccgtcccaaaactagctggtttgcagaggtgtg 148
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 ccaaacatggccatggatgctggagctccgtcccaaaactagctggtttgcagaggtgtg 120
Query: 149 ggaagagctgcaggttgaggtggataaattacctgaggcctgatttgaagagaggagcat 208
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ggaagagctgcaggttgaggtggataaattacctgaggcctgatttgaagagaggagcat 180
Query: 209 tctcacaacaggaagagaatttgatcattgaactccatgccgtccttggcaacaggtggg 268
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tctcacaacaggaagagaatttgatcattgaactccatgccgtccttggcaacaggtggg 240
Query: 269 ctcagattgcagcacagttaccaggaagaactgacaatgagattaaaaatctgtggaatt 328
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 ctcagattgcagcacagttaccaggaagaactgacaatgagattaaaaatctgtggaatt 300
Query: 329 catgccttaagaagaggctcaggcaaagaggcattgacccaagcacccaca 379
|||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 catgccttaagaagaggctcaggcaaagaggcattgacccaagcacccaca 351
>gnl|LJGI|FS328706 similar to UniRef100_A7Q0Y1 Cluster: Chromosome chr7 scaffold_42,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr7 scaffold_42, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (35%)
Length = 765
Score = 186 bits (94), Expect = 2e-46
Identities = 289/354 (81%)
Strand = Plus / Plus
Query: 1 atgggaagacactcttgctgctacaagcagaagctacgcaaaggtctctggtctccagag 60
|||||||||||||| |||||||||||||||||||| | || ||||| ||||| ||||||
Sbjct: 150 atgggaagacactcatgctgctacaagcagaagcttaggaagggtctgtggtcaccagag 209
Query: 61 gaagatgaaaagctcttgaatcacatcaccaaacatggccatggatgctggagctccgtc 120
|||||||| || || ||| || || || || ||||||||||||| ||||| || ||
Sbjct: 210 gaagatgagaaacttctgaggcatattacgaagtatggccatggatgttggagttctgtg 269
Query: 121 ccaaaactagctggtttgcagaggtgtgggaagagctgcaggttgaggtggataaattac 180
|| || | ||| ||||||||||||||||| |||||||||||| | |||||||| ||||||
Sbjct: 270 cctaagcaagcaggtttgcagaggtgtggtaagagctgcaggcttaggtggatcaattac 329
Query: 181 ctgaggcctgatttgaagagaggagcattctcacaacaggaagagaatttgatcattgaa 240
| ||||||||||| || |||||| ||||||||||| | ||||| ||| | || ||||||
Sbjct: 330 ttaaggcctgatttaaaaagaggaacattctcacaagaagaagaaaatcttataattgaa 389
Query: 241 ctccatgccgtccttggcaacaggtgggctcagattgcagcacagttaccaggaagaact 300
|| ||||| || || || ||||| ||| |||| ||||| || || || || ||||| ||
Sbjct: 390 cttcatgcagtactagggaacagatggtctcaaattgcggcgcaattgccgggaaggacc 449
Query: 301 gacaatgagattaaaaatctgtggaattcatgccttaagaagaggctcaggcaa 354
|||||||| || || ||||| ||||| || ||||| ||||||| ||| ||||||
Sbjct: 450 gacaatgaaataaagaatctttggaactcttgcctgaagaagaagctgaggcaa 503
>gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromosome chr17
scaffold_12, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr17 scaffold_12, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (19%)
Length = 487
Score = 95.6 bits (48), Expect = 6e-19
Identities = 135/164 (82%)
Strand = Plus / Plus
Query: 40 aaaggtctctggtctccagaggaagatgaaaagctcttgaatcacatcaccaaacatggc 99
|||||| | ||||| || || |||||||| |||||||| |||||||| |||| | |||
Sbjct: 318 aaaggtttatggtcccctgaagaagatgagaagctcttcaatcacataaccagatttggt 377
Query: 100 catggatgctggagctccgtcccaaaactagctggtttgcagaggtgtgggaagagctgc 159
||| |||||||| || || || |||| |||||| |||| || ||||| ||||| |||
Sbjct: 378 gttggttgctggagttctgttcccaaacaagctggactgcaaagatgtggaaagagttgc 437
Query: 160 aggttgaggtggataaattacctgaggcctgatttgaagagagg 203
|||||||| |||||||| ||| ||||||||||||||||||||||
Sbjct: 438 aggttgagatggataaactacttgaggcctgatttgaagagagg 481
>gnl|LJGI|AV776018 similar to UniRef100_Q0PJD4 Cluster: MYB transcription factor
MYB64; n=1; Glycine max|Rep: MYB transcription factor
MYB64 - Glycine max (Soybean), partial (52%)
Length = 476
Score = 67.9 bits (34), Expect = 1e-10
Identities = 88/106 (83%)
Strand = Plus / Plus
Query: 298 actgacaatgagattaaaaatctgtggaattcatgccttaagaagaggctcaggcaaaga 357
||||||||||| || || |||||||||||||| ||| | ||||||| ||||||||||||
Sbjct: 103 actgacaatgaaataaagaatctgtggaattcttgcttgaagaagaaactcaggcaaaga 162
Query: 358 ggcattgacccaagcacccacaagcctctctctgaggttgagaatg 403
|| || ||||| ||| || ||||| || ||||||||||| ||||
Sbjct: 163 ggtatagaccctgtcactcataagccactgtctgaggttgaaaatg 208
>gnl|LJGI|TC78802 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr14 scaffold_63, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (56%)
Length = 1242
Score = 67.9 bits (34), Expect = 1e-10
Identities = 55/62 (88%)
Strand = Plus / Plus
Query: 142 aggtgtgggaagagctgcaggttgaggtggataaattacctgaggcctgatttgaagaga 201
|||||||||||||| |||||| | ||||||| ||||||||||||||| || || ||||||
Sbjct: 322 aggtgtgggaagagttgcaggctcaggtggacaaattacctgaggccagacttaaagaga 381
Query: 202 gg 203
||
Sbjct: 382 gg 383
>gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
Glycine max|Rep: GmMYB29B2 protein - Glycine max
(Soybean), partial (81%)
Length = 1373
Score = 54.0 bits (27), Expect = 2e-06
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 274 attgcagcacagttaccaggaagaactgacaatgagattaaaaatctgtgg 324
||||||||| | |||||||||||||| |||||||| || |||||| |||||
Sbjct: 412 attgcagcaaaattaccaggaagaacagacaatgaaataaaaaatgtgtgg 462
>gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n=1; Malus x
domestica|Rep: MYB20 - Malus domestica (Apple) (Malus
sylvestris), partial (42%)
Length = 1348
Score = 52.0 bits (26), Expect = 8e-06
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 253 cttggcaacaggtgggctcagattgcagcacagttaccaggaagaactgacaatgagatt 312
||||| ||||| ||| |||| ||||| |||| ||||| || ||||||||||||||||||
Sbjct: 308 cttggaaacagatggtctcaaattgcggcacgcttacctgggagaactgacaatgagatt 367
Query: 313 aa 314
||
Sbjct: 368 aa 369