Miyakogusa Predicted Gene

Lj5g3v1533360.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1533360.1 Non Chatacterized Hit- tr|I1NET4|I1NET4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.28592
PE,65.01,0,HTH_MYB,Myb domain; SANT  SWI3, ADA2, N-CoR and TFIIIB''
DNA-bin,SANT/Myb domain; seg,NULL; no descr,CUFF.55443.1
         (1224 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB tra...   696   0.0  
gnl|LJGI|FS328706 similar to UniRef100_A7Q0Y1 Cluster: Chromosom...   186   2e-46
gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromos...    96   6e-19
gnl|LJGI|AV776018 similar to UniRef100_Q0PJD4 Cluster: MYB trans...    68   1e-10
gnl|LJGI|TC78802 similar to UniRef100_A7Q8B3 Cluster: Chromosome...    68   1e-10
gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 ...    54   2e-06
gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n...    52   8e-06

>gnl|LJGI|GO026297 homologue to UniRef100_Q0PJD6 Cluster: MYB transcription factor
           MYB160; n=1; Glycine max|Rep: MYB transcription factor
           MYB160 - Glycine max (Soybean), partial (60%)
          Length = 351

 Score =  696 bits (351), Expect = 0.0
 Identities = 351/351 (100%)
 Strand = Plus / Plus

                                                                       
Query: 29  agaagctacgcaaaggtctctggtctccagaggaagatgaaaagctcttgaatcacatca 88
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   agaagctacgcaaaggtctctggtctccagaggaagatgaaaagctcttgaatcacatca 60

                                                                       
Query: 89  ccaaacatggccatggatgctggagctccgtcccaaaactagctggtttgcagaggtgtg 148
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ccaaacatggccatggatgctggagctccgtcccaaaactagctggtttgcagaggtgtg 120

                                                                       
Query: 149 ggaagagctgcaggttgaggtggataaattacctgaggcctgatttgaagagaggagcat 208
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 ggaagagctgcaggttgaggtggataaattacctgaggcctgatttgaagagaggagcat 180

                                                                       
Query: 209 tctcacaacaggaagagaatttgatcattgaactccatgccgtccttggcaacaggtggg 268
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tctcacaacaggaagagaatttgatcattgaactccatgccgtccttggcaacaggtggg 240

                                                                       
Query: 269 ctcagattgcagcacagttaccaggaagaactgacaatgagattaaaaatctgtggaatt 328
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 ctcagattgcagcacagttaccaggaagaactgacaatgagattaaaaatctgtggaatt 300

                                                              
Query: 329 catgccttaagaagaggctcaggcaaagaggcattgacccaagcacccaca 379
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 catgccttaagaagaggctcaggcaaagaggcattgacccaagcacccaca 351


>gnl|LJGI|FS328706 similar to UniRef100_A7Q0Y1 Cluster: Chromosome chr7 scaffold_42,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_42, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (35%)
          Length = 765

 Score =  186 bits (94), Expect = 2e-46
 Identities = 289/354 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggaagacactcttgctgctacaagcagaagctacgcaaaggtctctggtctccagag 60
           |||||||||||||| ||||||||||||||||||||  | || ||||| ||||| ||||||
Sbjct: 150 atgggaagacactcatgctgctacaagcagaagcttaggaagggtctgtggtcaccagag 209

                                                                       
Query: 61  gaagatgaaaagctcttgaatcacatcaccaaacatggccatggatgctggagctccgtc 120
           |||||||| || ||  |||  || || || ||  ||||||||||||| ||||| || || 
Sbjct: 210 gaagatgagaaacttctgaggcatattacgaagtatggccatggatgttggagttctgtg 269

                                                                       
Query: 121 ccaaaactagctggtttgcagaggtgtgggaagagctgcaggttgaggtggataaattac 180
           || || | ||| ||||||||||||||||| |||||||||||| | |||||||| ||||||
Sbjct: 270 cctaagcaagcaggtttgcagaggtgtggtaagagctgcaggcttaggtggatcaattac 329

                                                                       
Query: 181 ctgaggcctgatttgaagagaggagcattctcacaacaggaagagaatttgatcattgaa 240
            | ||||||||||| || |||||| ||||||||||| | ||||| ||| | || ||||||
Sbjct: 330 ttaaggcctgatttaaaaagaggaacattctcacaagaagaagaaaatcttataattgaa 389

                                                                       
Query: 241 ctccatgccgtccttggcaacaggtgggctcagattgcagcacagttaccaggaagaact 300
           || ||||| || || || ||||| ||| |||| ||||| || || || || ||||| || 
Sbjct: 390 cttcatgcagtactagggaacagatggtctcaaattgcggcgcaattgccgggaaggacc 449

                                                                 
Query: 301 gacaatgagattaaaaatctgtggaattcatgccttaagaagaggctcaggcaa 354
           |||||||| || || ||||| ||||| || ||||| ||||||| ||| ||||||
Sbjct: 450 gacaatgaaataaagaatctttggaactcttgcctgaagaagaagctgaggcaa 503


>gnl|LJGI|BW624444 homologue to UniRef100_A7PCT7 Cluster: Chromosome chr17
           scaffold_12, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr17 scaffold_12, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (19%)
          Length = 487

 Score = 95.6 bits (48), Expect = 6e-19
 Identities = 135/164 (82%)
 Strand = Plus / Plus

                                                                       
Query: 40  aaaggtctctggtctccagaggaagatgaaaagctcttgaatcacatcaccaaacatggc 99
           |||||| | ||||| || || |||||||| |||||||| |||||||| |||| |  ||| 
Sbjct: 318 aaaggtttatggtcccctgaagaagatgagaagctcttcaatcacataaccagatttggt 377

                                                                       
Query: 100 catggatgctggagctccgtcccaaaactagctggtttgcagaggtgtgggaagagctgc 159
             ||| |||||||| || || || |||| ||||||  |||| || ||||| ||||| |||
Sbjct: 378 gttggttgctggagttctgttcccaaacaagctggactgcaaagatgtggaaagagttgc 437

                                                       
Query: 160 aggttgaggtggataaattacctgaggcctgatttgaagagagg 203
           |||||||| |||||||| ||| ||||||||||||||||||||||
Sbjct: 438 aggttgagatggataaactacttgaggcctgatttgaagagagg 481


>gnl|LJGI|AV776018 similar to UniRef100_Q0PJD4 Cluster: MYB transcription factor
           MYB64; n=1; Glycine max|Rep: MYB transcription factor
           MYB64 - Glycine max (Soybean), partial (52%)
          Length = 476

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 88/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 298 actgacaatgagattaaaaatctgtggaattcatgccttaagaagaggctcaggcaaaga 357
           ||||||||||| || || |||||||||||||| ||| | |||||||  ||||||||||||
Sbjct: 103 actgacaatgaaataaagaatctgtggaattcttgcttgaagaagaaactcaggcaaaga 162

                                                         
Query: 358 ggcattgacccaagcacccacaagcctctctctgaggttgagaatg 403
           || || |||||   ||| || ||||| || ||||||||||| ||||
Sbjct: 163 ggtatagaccctgtcactcataagccactgtctgaggttgaaaatg 208


>gnl|LJGI|TC78802 similar to UniRef100_A7Q8B3 Cluster: Chromosome chr14 scaffold_63,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_63, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (56%)
          Length = 1242

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 142 aggtgtgggaagagctgcaggttgaggtggataaattacctgaggcctgatttgaagaga 201
           |||||||||||||| |||||| | ||||||| ||||||||||||||| || || ||||||
Sbjct: 322 aggtgtgggaagagttgcaggctcaggtggacaaattacctgaggccagacttaaagaga 381

             
Query: 202 gg 203
           ||
Sbjct: 382 gg 383


>gnl|LJGI|TC58498 similar to UniRef100_Q9XIU5 Cluster: GmMYB29B2 protein; n=1;
           Glycine max|Rep: GmMYB29B2 protein - Glycine max
           (Soybean), partial (81%)
          Length = 1373

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 274 attgcagcacagttaccaggaagaactgacaatgagattaaaaatctgtgg 324
           ||||||||| | |||||||||||||| |||||||| || |||||| |||||
Sbjct: 412 attgcagcaaaattaccaggaagaacagacaatgaaataaaaaatgtgtgg 462


>gnl|LJGI|TC81472 homologue to UniRef100_Q2LME4 Cluster: MYB20; n=1; Malus x
           domestica|Rep: MYB20 - Malus domestica (Apple) (Malus
           sylvestris), partial (42%)
          Length = 1348

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 253 cttggcaacaggtgggctcagattgcagcacagttaccaggaagaactgacaatgagatt 312
           ||||| ||||| ||| |||| ||||| ||||  ||||| || ||||||||||||||||||
Sbjct: 308 cttggaaacagatggtctcaaattgcggcacgcttacctgggagaactgacaatgagatt 367

             
Query: 313 aa 314
           ||
Sbjct: 368 aa 369