Miyakogusa Predicted Gene
- Lj5g3v1514680.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v1514680.1 Non Chatacterized Hit- tr|I1NF01|I1NF01_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.54528
PE,62.33,2e-37,seg,NULL; H_PPase,Pyrophosphate-energised proton pump;
SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NU,gene.g61843.t1.1
(402 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75196 homologue to UniRef100_O22124 Cluster: Proton p... 82 3e-15
>gnl|LJGI|TC75196 homologue to UniRef100_O22124 Cluster: Proton pyrophosphatase; n=1;
Vigna radiata var. radiata|Rep: Proton pyrophosphatase -
Phaseolus aureus (Mung bean) (Vigna radiata), partial
(98%)
Length = 2323
Score = 81.8 bits (41), Expect = 3e-15
Identities = 149/185 (80%)
Strand = Plus / Plus
Query: 62 gtccagtgcaagaagtggcagattcctgcaggactggagctgcaacaaatgtgatttttg 121
|||| |||||||| || || ||||||||||||||||| ||||| || ||||| || ||||
Sbjct: 1353 gtcctgtgcaagatgttgctgattcctgcaggactggtgctgctaccaatgttatatttg 1412
Query: 122 gattggcactgggatacaaatcagtcattattcccatatttgctattgctgttgctattt 181
| | || |||||||||| || || |||||||| || ||||||||||| || |||||
Sbjct: 1413 gccttgccttgggatacaagtctgttattattccaatttttgctattgcaattagtattt 1472
Query: 182 atgtaagcttcagtcttgccgctatgtatggaattgctgttgcagtccttggaatgctca 241
||| || ||||| ||||||| ||||| || || |||||||| | ||||||||||| |
Sbjct: 1473 ttgttagtttcagctttgccgccatgtacggtatcgctgttgctgcacttggaatgctga 1532
Query: 242 gtacc 246
|||||
Sbjct: 1533 gtacc 1537