Miyakogusa Predicted Gene

Lj5g3v1453360.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1453360.1 Non Chatacterized Hit- tr|I1JRE7|I1JRE7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.37130
PE,67.65,0.000000000000002,seg,NULL,CUFF.55285.1
         (300 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70644 weakly similar to UniRef100_Q4RSI9 Cluster: Chr...   101   2e-21

>gnl|LJGI|TC70644 weakly similar to UniRef100_Q4RSI9 Cluster: Chromosome 13
           SCAF15000, whole genome shotgun sequence; n=1; Tetraodon
           nigroviridis|Rep: Chromosome 13 SCAF15000, whole genome
           shotgun sequence - Tetraodon nigroviridis (Green
           puffer), partial (15%)
          Length = 523

 Score =  101 bits (51), Expect = 2e-21
 Identities = 51/51 (100%)
 Strand = Plus / Plus

                                                              
Query: 250 atgactcatgttttcagtgatgagaacactgagagttgcagcatcatgtaa 300
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 353 atgactcatgttttcagtgatgagaacactgagagttgcagcatcatgtaa 403