Miyakogusa Predicted Gene

Lj5g3v1415280.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1415280.1 tr|K1PLH3|K1PLH3_CRAGI Retinoblastoma-associated
protein OS=Crassostrea gigas PE=4
SV=1,42.22,1.6,seg,NULL,gene.g61673.t1.1
         (606 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70170 weakly similar to UniRef100_A6H573 Cluster: Cel...   151   6e-36
gnl|LJGI|TC73030                                                      141   6e-33
gnl|LJGI|BP044806 weakly similar to UniRef100_Q010M7 Cluster: Pr...    60   2e-08
gnl|LJGI|TC66929 similar to UniRef100_A8HYV0 Cluster: Predicted ...    60   2e-08
gnl|LJGI|AV775660                                                      58   7e-08

>gnl|LJGI|TC70170 weakly similar to UniRef100_A6H573 Cluster: Cell-wall anchoring
           protein precursor; n=1; Ruminococcus flavefaciens|Rep:
           Cell-wall anchoring protein precursor - Ruminococcus
           flavefaciens, partial (8%)
          Length = 573

 Score =  151 bits (76), Expect = 6e-36
 Identities = 79/80 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgttctctctaagtcggtttcacggtcttaacctatggaacgagtcttcaagtgtgatt 60
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 422 atgttctctttaagtcggtttcacggtcttaacctatggaacgagtcttcaagtgtgatt 363

                               
Query: 61  tccttgattagtatcatcag 80
           ||||||||||||||||||||
Sbjct: 362 tccttgattagtatcatcag 343


>gnl|LJGI|TC73030 
          Length = 609

 Score =  141 bits (71), Expect = 6e-33
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                       
Query: 381 ttccgaaagcacgatgggtcttctctcgaacttggagagagcagatcgatggagatctga 440
           |||||||||||| ||||||||||||||||||||||| ||||||||| |||| ||||||||
Sbjct: 4   ttccgaaagcacaatgggtcttctctcgaacttggacagagcagattgatgaagatctga 63

                                                  
Query: 441 gttggggatcttctccgagcccacgcccttgctccgccg 479
           | |||||| || |||||||||||||||||||||||||||
Sbjct: 64  gctggggaactcctccgagcccacgcccttgctccgccg 102


>gnl|LJGI|BP044806 weakly similar to UniRef100_Q010M7 Cluster: Predicted membrane
           protein; n=1; Ostreococcus tauri|Rep: Predicted membrane
           protein -, partial (1%)
          Length = 538

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 538 aagaagaagatgaaggaggaggagatgaag 567
           ||||||||||||||||||||||||||||||
Sbjct: 224 aagaagaagatgaaggaggaggagatgaag 195


>gnl|LJGI|TC66929 similar to UniRef100_A8HYV0 Cluster: Predicted protein; n=1;
           Chlamydomonas reinhardtii|Rep: Predicted protein -
           Chlamydomonas reinhardtii, partial (5%)
          Length = 591

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 290 gccaccaccacttctgggtctcaatctcctgggtttcttctt 331
           ||||||||||||| ||||||||| ||| ||||||||||||||
Sbjct: 424 gccaccaccacttatgggtctcactcttctgggtttcttctt 465


>gnl|LJGI|AV775660 
          Length = 487

 Score = 58.0 bits (29), Expect = 7e-08
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 427 cgatggagatctgagttggggatcttctccgagccca 463
           |||||||||||||| |||||||||| |||||||||||
Sbjct: 487 cgatggagatctgacttggggatctcctccgagccca 451