Miyakogusa Predicted Gene

Lj5g3v1341900.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1341900.1 tr|I3SNU6|I3SNU6_LOTJA Serine/threonine-protein
phosphatase OS=Lotus japonicus PE=2
SV=1,100,2e-40,Metallophos,Metallophosphoesterase domain; no
description,NULL; Metallo-dependent phosphatases,NULL;,CUFF.55163.1
         (307 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62023 homologue to UniRef100_Q0EAF2 Cluster: Serine/t...   468   e-131
gnl|LJGI|TC75829 homologue to UniRef100_Q0EAF3 Cluster: Serine/t...   101   2e-21
gnl|LJGI|TC60466 homologue to UniRef100_Q9MB26 Cluster: Serine/t...    66   1e-10
gnl|LJGI|GO005171 similar to UniRef100_O65846 Cluster: Serine/th...    56   1e-07

>gnl|LJGI|TC62023 homologue to UniRef100_Q0EAF2 Cluster: Serine/threonine protein
           phosphatase; n=1; Vicia faba|Rep: Serine/threonine
           protein phosphatase - Vicia faba (Broad bean), partial
           (98%)
          Length = 1525

 Score =  468 bits (236), Expect = e-131
 Identities = 236/236 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcacgggggactttctcccgacttaaataacttggatcagattagaaatcttcagcgg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 716 atgcacgggggactttctcccgacttaaataacttggatcagattagaaatcttcagcgg 775

                                                                       
Query: 61  ccaactgatgtgcctgatacaggtttgctttgtgatctcctgtggtcagatccaagcaaa 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 776 ccaactgatgtgcctgatacaggtttgctttgtgatctcctgtggtcagatccaagcaaa 835

                                                                       
Query: 121 gaaattcagggttggggaatgaatgacaggggagtttcatatacatttggtgctgataag 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 836 gaaattcagggttggggaatgaatgacaggggagtttcatatacatttggtgctgataag 895

                                                                   
Query: 181 gtctctgagtttcttcagaaacatgatttggatcttatttgtcgagctcatcaggt 236
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 896 gtctctgagtttcttcagaaacatgatttggatcttatttgtcgagctcatcaggt 951


>gnl|LJGI|TC75829 homologue to UniRef100_Q0EAF3 Cluster: Serine/threonine protein
           phosphatase; n=1; Vicia faba|Rep: Serine/threonine
           protein phosphatase - Vicia faba (Broad bean), partial
           (64%)
          Length = 755

 Score =  101 bits (51), Expect = 2e-21
 Identities = 93/107 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcacgggggactttctcccgacttaaataacttggatcagattagaaatcttcagcgg 60
           ||||| || ||| ||||||| |||||| |||| |||||||||||||||||||  ||||||
Sbjct: 627 atgcatggaggaatttctccggacttacataatttggatcagattagaaatcaacagcgg 686

                                                          
Query: 61  ccaactgatgtgcctgatacaggtttgctttgtgatctcctgtggtc 107
           || |||||||| |||| ||||||||| ||||||||||| || |||||
Sbjct: 687 cctactgatgttcctggtacaggtttactttgtgatcttctttggtc 733


>gnl|LJGI|TC60466 homologue to UniRef100_Q9MB26 Cluster: Serine/threonine protein
           phosphatase; n=2; Vicia faba|Rep: Serine/threonine
           protein phosphatase - Vicia faba (Broad bean), partial
           (98%)
          Length = 1520

 Score = 65.9 bits (33), Expect = 1e-10
 Identities = 92/109 (84%), Gaps = 2/109 (1%)
 Strand = Plus / Plus

                                                                       
Query: 130 ggttggggaatgaatgacaggggagtttcatatacatttggtgctgataaggtctctgag 189
           |||||||| ||||||||||| ||||| || || || || ||| | |||||||| ||||||
Sbjct: 826 ggttggggtatgaatgacagaggagtctcgtacaccttcggtcccgataaggtgtctgag 885

                                                            
Query: 190 tttcttcagaaa-catgatttggatcttatttgtcgagctcatcaggtt 237
           ||| || | ||| ||||| ||||| ||||||||||| ||||||||||||
Sbjct: 886 ttt-ttgacaaagcatgacttggaccttatttgtcgtgctcatcaggtt 933


>gnl|LJGI|GO005171 similar to UniRef100_O65846 Cluster: Serine/threonine protein
           phosphatase; n=1; Medicago sativa|Rep: Serine/threonine
           protein phosphatase - Medicago sativa (Alfalfa), partial
           (71%)
          Length = 746

 Score = 56.0 bits (28), Expect = 1e-07
 Identities = 71/84 (84%), Gaps = 1/84 (1%)
 Strand = Plus / Plus

                                                                       
Query: 91  tgtgatctcctgtggtcagatccaagcaaagaaattcagggttggggaatgaatgacagg 150
           ||||||||| ||||||| ||||| || ||||| ||||||  | ||||||||| |||  | 
Sbjct: 612 tgtgatctcttgtggtctgatcctagtaaagagattcagact-ggggaatgagtgaacgt 670

                                   
Query: 151 ggagtttcatatacatttggtgct 174
           |||||||||||||| |||||||||
Sbjct: 671 ggagtttcatatacttttggtgct 694