Miyakogusa Predicted Gene
- Lj5g3v1329790.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v1329790.1 Non Chatacterized Hit- tr|I1NIL8|I1NIL8_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,79.35,0,Response_reg,Signal transduction response regulator,
receiver domain; GAF,GAF domain; HisKA,Signal t,CUFF.55148.1
(2298 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC79886 similar to UniRef100_A4ZPP4 Cluster: Ethylene r... 442 e-123
>gnl|LJGI|TC79886 similar to UniRef100_A4ZPP4 Cluster: Ethylene receptor; n=1; Glycine
max|Rep: Ethylene receptor - Glycine max (Soybean),
partial (40%)
Length = 289
Score = 442 bits (223), Expect = e-123
Identities = 223/223 (100%)
Strand = Plus / Plus
Query: 2076 catgcctgaaatggacggttttgaagtggcggcgaggattcagaactttaataggccgaa 2135
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 catgcctgaaatggacggttttgaagtggcggcgaggattcagaactttaataggccgaa 60
Query: 2136 ttggcccttgattgtcgccttcatagcaagtgcagaagagcatgtgaaggagaagtgcct 2195
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 ttggcccttgattgtcgccttcatagcaagtgcagaagagcatgtgaaggagaagtgcct 120
Query: 2196 gctagcgggaatgaatgggttgattcggaaacctatcatccttcatgagattgcagatga 2255
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gctagcgggaatgaatgggttgattcggaaacctatcatccttcatgagattgcagatga 180
Query: 2256 acttagatctgtcctccaacgtgcaggtgaaaaactttagaga 2298
|||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 acttagatctgtcctccaacgtgcaggtgaaaaactttagaga 223