Miyakogusa Predicted Gene

Lj5g3v1303330.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1303330.1 tr|G7I5M8|G7I5M8_MEDTR Protein kinase-like
protein OS=Medicago truncatula GN=MTR_1g079430 PE=4
SV=1,60.22,0,seg,NULL; Protein kinase-like (PK-like),Protein
kinase-like domain; PROTEIN_KINASE_DOM,Protein kinas,CUFF.55127.1
         (1842 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66109 homologue to UniRef100_A9STC4 Cluster: Predicte...    56   8e-07
gnl|LJGI|TC63429 homologue to UniRef100_A9STC4 Cluster: Predicte...    56   8e-07

>gnl|LJGI|TC66109 homologue to UniRef100_A9STC4 Cluster: Predicted protein; n=1;
           Physcomitrella patens subsp. patens|Rep: Predicted
           protein - Physcomitrella patens subsp. patens, partial
           (24%)
          Length = 769

 Score = 56.0 bits (28), Expect = 8e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 382 gtgaatctcattggttattgtgctgatggggaccaacgtctcttggtgtatgaatt 437
           |||||||||||||| || ||||| ||||| |||||||| ||| |||| ||||||||
Sbjct: 696 gtgaatctcattggatactgtgcggatggagaccaacgcctcctggtttatgaatt 751


>gnl|LJGI|TC63429 homologue to UniRef100_A9STC4 Cluster: Predicted protein; n=1;
           Physcomitrella patens subsp. patens|Rep: Predicted
           protein - Physcomitrella patens subsp. patens, partial
           (41%)
          Length = 1006

 Score = 56.0 bits (28), Expect = 8e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 382 gtgaatctcattggttattgtgctgatggggaccaacgtctcttggtgtatgaatt 437
           |||||||||||||| || ||||| ||||| |||||||| ||| |||| ||||||||
Sbjct: 723 gtgaatctcattggatactgtgcggatggagaccaacgcctcctggtttatgaatt 778