Miyakogusa Predicted Gene

Lj5g3v1302260.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1302260.1 Non Chatacterized Hit- tr|I1LBU9|I1LBU9_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,79.89,0,seg,NULL; no
description,NULL; no description,Peptidase S8/S53,
subtilisin/kexin/sedolisin; SUBTILIS,CUFF.55121.1
         (2289 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV775617 UniRef100_Q58LL1 Cluster: Fiber; n=1; Prochlor...    66   1e-09
gnl|LJGI|TC65352 similar to UniRef100_A7P8A1 Cluster: Chromosome...    56   1e-06

>gnl|LJGI|AV775617 UniRef100_Q58LL1 Cluster: Fiber; n=1; Prochlorococcus phage
           P-SSM4|Rep: Fiber - Prochlorococcus phage P-SSM4,
           partial (0%)
          Length = 298

 Score = 65.9 bits (33), Expect = 1e-09
 Identities = 43/45 (95%), Gaps = 1/45 (2%)
 Strand = Plus / Plus

                                                        
Query: 3   ggagtgttgtcactttatggctccatttcca-ttgatgttcctaa 46
           ||||||||||||||||||||||||||||||| | |||||||||||
Sbjct: 150 ggagtgttgtcactttatggctccatttccagtggatgttcctaa 194


>gnl|LJGI|TC65352 similar to UniRef100_A7P8A1 Cluster: Chromosome chr3 scaffold_8,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr3 scaffold_8, whole genome shotgun sequence
            - Vitis vinifera (Grape), partial (28%)
          Length = 997

 Score = 56.0 bits (28), Expect = 1e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 1666 ttgctgaaatcagcacacccagattggagccc 1697
            ||||||||||||||||| ||||||||||||||
Sbjct: 35   ttgctgaaatcagcacatccagattggagccc 66