Miyakogusa Predicted Gene

Lj5g3v1262960.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1262960.1 tr|Q9ZSQ5|Q9ZSQ5_ASTPN Granule-bound glycogen
(Starch) synthase OS=Astragalus penduliflorus PE=2
SV=,52.69,0.00000000000003, ,CUFF.55104.1
         (274 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61354 similar to UniRef100_Q9ZSQ5 Cluster: Granule-bo...   543   e-154

>gnl|LJGI|TC61354 similar to UniRef100_Q9ZSQ5 Cluster: Granule-bound glycogen
           (Starch) synthase; n=1; Astragalus membranaceus|Rep:
           Granule-bound glycogen (Starch) synthase - Astragalus
           membranaceus (Chinese milk-vetch) (Huang qi), partial
           (59%)
          Length = 1306

 Score =  543 bits (274), Expect = e-154
 Identities = 274/274 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggcaactgtaacggcctcatcatacgcggtgtcaagaagcgcgtgcctcaaccgccat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 atggcaactgtaacggcctcatcatacgcggtgtcaagaagcgcgtgcctcaaccgccat 180

                                                                       
Query: 61  ggaagaacagactctgctgctgccaaagtgaattcggtgactctcggtggccacgcgctg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 ggaagaacagactctgctgctgccaaagtgaattcggtgactctcggtggccacgcgctg 240

                                                                       
Query: 121 gtttacgatgggttgagatctctcaacaagttgcacgtgcgatccgcacgtgcggtgaaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 gtttacgatgggttgagatctctcaacaagttgcacgtgcgatccgcacgtgcggtgaaa 300

                                                                       
Query: 181 ggcttgtcgtcgacggcgagtgacggaggagccgcgcgtggtaaggcttccggggaggtt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301 ggcttgtcgtcgacggcgagtgacggaggagccgcgcgtggtaaggcttccggggaggtt 360

                                             
Query: 241 gtgtgtgggatgaacttggtgttcgtcggagctg 274
           ||||||||||||||||||||||||||||||||||
Sbjct: 361 gtgtgtgggatgaacttggtgttcgtcggagctg 394