Miyakogusa Predicted Gene

Lj5g3v1208320.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1208320.1 CUFF.55042.1
         (2142 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61971 similar to UniRef100_Q84VU1 Cluster: 65kD micro...    62   2e-08

>gnl|LJGI|TC61971 similar to UniRef100_Q84VU1 Cluster: 65kD microtubule associated
            protein; n=1; Daucus carota|Rep: 65kD microtubule
            associated protein - Daucus carota (Carrot), partial
            (36%)
          Length = 933

 Score = 61.9 bits (31), Expect = 2e-08
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1092 tcagatagcgcaagtcaaagaggaagcttttggccgaaaagaaatacttgagaaggttga 1151
            |||||||||| |||  ||||| ||||||||  |||||||||| ||| | || ||||||||
Sbjct: 69   tcagatagcgaaagcgaaagaagaagctttaagccgaaaagatatattggacaaggttga 128

                                                   
Query: 1152 gaaatggttaggagcatgtgatgaagagtcttggcttga 1190
            ||||||| |   ||||||||| ||||||  |||||||||
Sbjct: 129  gaaatggatgtcagcatgtgaagaagagagttggcttga 167