Miyakogusa Predicted Gene

Lj5g3v1190110.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v1190110.1 CUFF.54951.1
         (346 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS349224 similar to UniRef100_Q9R8Y7 Cluster: Nodulatio...    50   9e-06

>gnl|LJGI|FS349224 similar to UniRef100_Q9R8Y7 Cluster: Nodulation protein C; n=1;
           Rhizobium sp. CC2155|Rep: Nodulation protein C -
           Rhizobium sp. CC2155, partial (7%)
          Length = 673

 Score = 50.1 bits (25), Expect = 9e-06
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 129 ttacaatcactcattctctcactattctgttag 161
           ||||||||||||| |||||| ||||||||||||
Sbjct: 184 ttacaatcactcaatctctctctattctgttag 216