Miyakogusa Predicted Gene

Lj5g3v0962670.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0962670.1 Non Chatacterized Hit- tr|G7LCB4|G7LCB4_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,41.67,0.000003,seg,NULL; coiled-coil,NULL,CUFF.54364.1
         (823 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL...   392   e-108
gnl|LJGI|TC73005                                                      250   1e-65
gnl|LJGI|FS340012                                                     246   2e-64
gnl|LJGI|TC74530 similar to UniRef100_Q0DSN5 Cluster: Os03g02977...   163   2e-39
gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Ea...   141   8e-33
gnl|LJGI|BW599624 similar to UniRef100_A8ZSC6 Cluster: TonB-depe...    56   4e-07

>gnl|LJGI|TC72234 weakly similar to UniRef100_Q75CJ3 Cluster: ACL074Wp; n=1;
           Eremothecium gossypii|Rep: ACL074Wp - Ashbya gossypii
           (Yeast) (Eremothecium gossypii), partial (8%)
          Length = 691

 Score =  392 bits (198), Expect = e-108
 Identities = 300/334 (89%)
 Strand = Plus / Minus

                                                                       
Query: 27  ggcttatggatggatcatcaccgtggagcagtactgtgaggcgaagggaatatcagaaga 86
           ||||||||||||| ||||||| ||||||||  |||||||||| || ||| |||| |||||
Sbjct: 681 ggcttatggatgggtcatcacggtggagcaacactgtgaggctaaaggagtatctgaaga 622

                                                                       
Query: 87  gaagaaattctcagaggcggagaaggcattggcgcgtgatgcgctcttttggtggtattc 146
           |||||||||||||||||| |||||||  ||| ||||||||||| ||||||||||||||||
Sbjct: 621 gaagaaattctcagaggcagagaaggtgttgacgcgtgatgcgttcttttggtggtattc 562

                                                                       
Query: 147 ctggaaaaaacgaaatcagagggcaaaatggtgggattttgtgatagcattgttgagaga 206
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||
Sbjct: 561 ctggaaaaaacgaaatcagagggcaaaatggtgggattttgtgatagcattgctgaggga 502

                                                                       
Query: 207 attcgaaccagaatcggaactgtatctgccagacctagttgcagattcagaggaggaaga 266
           ||||||||||||||||||||||||||||||||| | ||||| |||||||| |||||||||
Sbjct: 501 attcgaaccagaatcggaactgtatctgccagatccagttgaagattcaggggaggaaga 442

                                                                       
Query: 267 aattcctggacaagaagaaattcataaggatgacgccagaaaagccaaggaagaaaaccg 326
           ||||||| || ||||||||||||| ||||| || ||||||||   ||||| |  ||||| 
Sbjct: 441 aattccttgagaagaagaaattcagaaggaagaagccagaaacatcaaggcatcaaacct 382

                                             
Query: 327 ggaaatcagaagaaattggtgtgaagattggatc 360
           |||| | |||||||||||||||||||| ||||||
Sbjct: 381 ggaactgagaagaaattggtgtgaagaatggatc 348


>gnl|LJGI|TC73005 
          Length = 812

 Score =  250 bits (126), Expect = 1e-65
 Identities = 177/194 (91%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgtttccagaatttaatggaagtgtggcttatggatggatcatcaccgtggagcagtac 60
           ||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 196 atgtttccagaatttgatggaagagtggcttatggatggatcatcaccgtagagcagtac 137

                                                                       
Query: 61  tgtgaggcgaagggaatatcagaagagaagaaattctcagaggcggagaaggcattggcg 120
           |||||||| |||||||||||||| |||||||||||||||| |||||||||||||||| ||
Sbjct: 136 tgtgaggccaagggaatatcagaggagaagaaattctcagtggcggagaaggcattgacg 77

                                                                       
Query: 121 cgtgatgcgctcttttggtggtattcctggaaaaaacgaaatcagagggcaaaatggtgg 180
           |||||||||||| |||||||| |   |||||||| | ||||||||||||||| ||||  |
Sbjct: 76  cgtgatgcgctcctttggtggaacgactggaaaagaagaaatcagagggcaacatggatg 17

                         
Query: 181 gattttgtgatagc 194
           ||||||||||||||
Sbjct: 16  gattttgtgatagc 3


>gnl|LJGI|FS340012 
          Length = 685

 Score =  246 bits (124), Expect = 2e-64
 Identities = 232/268 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtttccagaatttaatggaagtgtggcttatggatggatcatcaccgtggagcagtac 60
           ||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 283 atgtttccagaatttgatggaagagtggcttatggatggatcatcaccgtagagcagtac 342

                                                                       
Query: 61  tgtgaggcgaagggaatatcagaagagaagaaattctcagaggcggagaaggcattggcg 120
           |||||||| |||||||||||||| |||||||||||||||| |||||||||||||||| ||
Sbjct: 343 tgtgaggccaagggaatatcagaggagaagaaattctcagtggcggagaaggcattgacg 402

                                                                       
Query: 121 cgtgatgcgctcttttggtggtattcctggaaaaaacgaaatcagagggcaaaatggtgg 180
           |||||||| ||| |||||||| |   |||||||| | ||||||||||||||| ||||  |
Sbjct: 403 cgtgatgctctcctttggtggaacgactggaaaagaagaaatcagagggcaacatggatg 462

                                                                       
Query: 181 gattttgtgatagcattgttgagagaattcgaaccagaatcggaactgtatctgccagac 240
           ||||||||||||||  |  | ||| ||||||||||||| || ||  ||| ||||||||| 
Sbjct: 463 gattttgtgatagctctactcagaaaattcgaaccagattctgatttgtttctgccagat 522

                                       
Query: 241 ctagttgcagattcagaggaggaagaaa 268
           | ||||  |||| | | |||||||||||
Sbjct: 523 ccagttcaagatactggggaggaagaaa 550


>gnl|LJGI|TC74530 similar to UniRef100_Q0DSN5 Cluster: Os03g0297700 protein; n=1;
           Oryza sativa Japonica Group|Rep: Os03g0297700 protein -
           Oryza sativa subsp. japonica (Rice), partial (21%)
          Length = 749

 Score =  163 bits (82), Expect = 2e-39
 Identities = 184/218 (84%)
 Strand = Plus / Minus

                                                                       
Query: 1   atgtttccagaatttaatggaagtgtggcttatggatggatcatcaccgtggagcagtac 60
           ||||||||||| ||| |||| ||   ||||||||||||||||||||| | ||||||  ||
Sbjct: 721 atgtttccagagtttgatgggagatgggcttatggatggatcatcacaggggagcaacac 662

                                                                       
Query: 61  tgtgaggcgaagggaatatcagaagagaagaaattctcagaggcggagaaggcattggcg 120
           |||||||| || ||| |||| ||||||||||||||||||||||| | |||||| ||| | 
Sbjct: 661 tgtgaggccaaaggagtatccgaagagaagaaattctcagaggcagcgaaggcgttgaca 602

                                                                       
Query: 121 cgtgatgcgctcttttggtggtattcctggaaaaaacgaaatcagagggcaaaatggtgg 180
           | |||||||||  ||||||||||   |||||||| | ||||||||||||||| ||||  |
Sbjct: 601 catgatgcgctgatttggtggtacgactggaaaagaagaaatcagagggcaacatggatg 542

                                                 
Query: 181 gattttgtgatagcattgttgagagaattcgaaccaga 218
           |||||||||||||||||  | ||| |||||||||||||
Sbjct: 541 gattttgtgatagcattactaagaaaattcgaaccaga 504


>gnl|LJGI|BW601534 weakly similar to UniRef100_P08046 Cluster: Early growth response
           protein 1; n=2; Mus musculus|Rep: Early growth response
           protein 1 - Mus musculus (Mouse), partial (4%)
          Length = 479

 Score =  141 bits (71), Expect = 8e-33
 Identities = 224/275 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtttccagaatttaatggaagtgtggcttatggatggatcatcaccgtggagcagtac 60
           ||||||||||||||| ||||||| | ||| || |||||| |||| |  ||||||||  ||
Sbjct: 75  atgtttccagaatttgatggaagagaggcctacggatggctcattatggtggagcaacac 134

                                                                       
Query: 61  tgtgaggcgaagggaatatcagaagagaagaaattctcagaggcggagaaggcattggcg 120
           |||||||| |||||| |||| |||||| |||||||||||| ||| |||||||| ||| | 
Sbjct: 135 tgtgaggccaagggagtatccgaagaggagaaattctcaggggcagagaaggctttgact 194

                                                                       
Query: 121 cgtgatgcgctcttttggtggtattcctggaaaaaacgaaatcagagggcaaaatggtgg 180
            |||| ||  || | ||||||| || ||||| || ||| ||||||| ||||| |||||||
Sbjct: 195 ggtgaagctttcatgtggtggttttgctggagaagacgcaatcagaaggcaacatggtgg 254

                                                                       
Query: 181 gattttgtgatagcattgttgagagaattcgaaccagaatcggaactgtatctgccagac 240
           || ||||||   ||  |||||||  ||||||||||||||| ||||| |||  ||||||| 
Sbjct: 255 gaatttgtggaggctctgttgaggaaattcgaaccagaattggaaccgtacatgccagaa 314

                                              
Query: 241 ctagttgcagattcagaggaggaagaaattcctgg 275
           | |||   ||||||||||||||||||||| |||||
Sbjct: 315 ccagtccaagattcagaggaggaagaaatccctgg 349


>gnl|LJGI|BW599624 similar to UniRef100_A8ZSC6 Cluster: TonB-dependent receptor plug;
           n=1; Desulfococcus oleovorans Hxd3|Rep: TonB-dependent,
           partial (2%)
          Length = 515

 Score = 56.0 bits (28), Expect = 4e-07
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 1   atgtttccagaatttaatggaagtgtggcttatggatggatcatcaccgtggagca 56
           ||||||||||||||| |||| ||   ||||||||||||| ||||||| ||||||||
Sbjct: 250 atgtttccagaatttgatgggagatgggcttatggatgggtcatcacggtggagca 195