Miyakogusa Predicted Gene
- Lj5g3v0875230.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v0875230.1 Non Chatacterized Hit- tr|I3SEH7|I3SEH7_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=4
SV=1,98.36,4e-26,seg,NULL,CUFF.54111.1
(187 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC65326 similar to UniRef100_Q0GGS9 Cluster: S-adenosyl... 363 e-100
gnl|LJGI|TC72761 homologue to UniRef100_O23255 Cluster: Adenosyl... 80 5e-15
gnl|LJGI|FS320045 homologue to UniRef100_Q2PEU5 Cluster: Adenosy... 68 2e-11
gnl|LJGI|TC71310 similar to UniRef100_A5C5K3 Cluster: Adenosylho... 50 5e-06
>gnl|LJGI|TC65326 similar to UniRef100_Q0GGS9 Cluster: S-adenosyl-L-homocysteine
hydrolase; n=1; Caragana jubata|Rep:
S-adenosyl-L-homocysteine hydrolase - Caragana jubata,
partial (18%)
Length = 657
Score = 363 bits (183), Expect = e-100
Identities = 186/187 (99%)
Strand = Plus / Minus
Query: 1 atggtcgtctcctcaccccaacaagcctctccttcgtcttgcggtaaccccaacatgcct 60
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 363 atggtcgcctcctcaccccaacaagcctctccttcgtcttgcggtaaccccaacatgcct 304
Query: 61 ctccttcgtcttacggtacctctgagggtcgttctccatcccatccctaatgatggtgag 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 303 ctccttcgtcttacggtacctctgagggtcgttctccatcccatccctaatgatggtgag 244
Query: 121 cactatctggaactcggcgttgtcggtggaagctatggtacctgggttttgttggttcac 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 243 cactatctggaactcggcgttgtcggtggaagctatggtacctgggttttgttggttcac 184
Query: 181 aattgag 187
|||||||
Sbjct: 183 aattgag 177
>gnl|LJGI|TC72761 homologue to UniRef100_O23255 Cluster: Adenosylhomocysteinase 1;
n=1; Arabidopsis thaliana|Rep: Adenosylhomocysteinase 1
- Arabidopsis thaliana (Mouse-ear cress), complete
Length = 1947
Score = 79.8 bits (40), Expect = 5e-15
Identities = 82/96 (85%)
Strand = Plus / Minus
Query: 57 gcctctccttcgtcttacggtacctctgagggtcgttctccatcccatccctaatgatgg 116
||||||||||| |||| |||||||| || | ||| ||| || ||||||||| |||||||
Sbjct: 753 gcctctccttcatcttgcggtacctatgggagtcagtcttcaacccatccctgatgatgg 694
Query: 117 tgagcactatctggaactcggcgttgtcggtggaag 152
| ||||| ||||||||||| | ||||||||||||||
Sbjct: 693 taagcacgatctggaactcagggttgtcggtggaag 658
>gnl|LJGI|FS320045 homologue to UniRef100_Q2PEU5 Cluster: Adenosylhomocysteinase; n=1;
Trifolium pratense|Rep: Adenosylhomocysteinase -
Trifolium pratense (Red clover), partial (40%)
Length = 639
Score = 67.9 bits (34), Expect = 2e-11
Identities = 76/90 (84%)
Strand = Plus / Minus
Query: 64 cttcgtcttacggtacctctgagggtcgttctccatcccatccctaatgatggtgagcac 123
|||| |||| |||||||| ||||| ||| ||| || ||| ||||| |||||||| |||||
Sbjct: 639 cttcatcttgcggtacctgtgaggatcggtcttcaacccgtccctgatgatggtaagcac 580
Query: 124 tatctggaactcggcgttgtcggtggaagc 153
||||||||||| || ||||| ||||||||
Sbjct: 579 gatctggaactcagcattgtcagtggaagc 550
>gnl|LJGI|TC71310 similar to UniRef100_A5C5K3 Cluster: Adenosylhomocysteinase; n=1;
Vitis vinifera|Rep: Adenosylhomocysteinase - Vitis
vinifera (Grape), partial (13%)
Length = 587
Score = 50.1 bits (25), Expect = 5e-06
Identities = 44/49 (89%), Gaps = 1/49 (2%)
Strand = Plus / Minus
Query: 104 tccctaatgatggtgagcactatctggaactcggcgttgtcggtggaag 152
||||| |||||||||||||| || |||||||||| ||||| ||||||||
Sbjct: 110 tccctgatgatggtgagcacgatatggaactcgg-gttgttggtggaag 63