Miyakogusa Predicted Gene

Lj5g3v0845680.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0845680.1 Non Chatacterized Hit- tr|C6T2Q7|C6T2Q7_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.32174 PE,64.56,2e-16,
,NODE_47039_length_881_cov_189.098755.path2.1
         (233 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC63135 similar to UniRef100_Q6X182 Cluster: Mal d 1-as...   454   e-127

>gnl|LJGI|TC63135 similar to UniRef100_Q6X182 Cluster: Mal d 1-associated protein; n=1;
            Malus x domestica|Rep: Mal d 1-associated protein - Malus
            domestica (Apple) (Malus sylvestris), partial (56%)
          Length = 1198

 Score =  454 bits (229), Expect = e-127
 Identities = 232/233 (99%)
 Strand = Plus / Plus

                                                                        
Query: 1    atggaacgaagcctctttggtggtgttagtcgtttcttcgatgcagctgaagaaatgaag 60
            |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 772  atggaacgaagcctctttggtggtcttagtcgtttcttcgatgcagctgaagaaatgaag 831

                                                                        
Query: 61   aatggcttctttgatgtttttggcaacgtattagatgcagaatccccatcttcctcatct 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 832  aatggcttctttgatgtttttggcaacgtattagatgcagaatccccatcttcctcatct 891

                                                                        
Query: 121  atgagacgagggatccctattgaagagtacaatcggcaagaagcttctcctaaaccccag 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 892  atgagacgagggatccctattgaagagtacaatcggcaagaagcttctcctaaaccccag 951

                                                                 
Query: 181  gaaaaggaaccagtggatactgatttcgctgcattggctaaagatgtttgagt 233
            |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 952  gaaaaggaaccagtggatactgatttcgctgcattggctaaagatgtttgagt 1004