Miyakogusa Predicted Gene
- Lj5g3v0837720.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v0837720.1 tr|G7K6A2|G7K6A2_MEDTR F-box/kelch-repeat protein
OS=Medicago truncatula GN=MTR_5g069760 PE=4 SV=1,40.32,2e-17,
,CUFF.54017.1
(381 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO035798 weakly similar to UniRef100_Q12X80 Cluster: 4F... 565 e-161
gnl|LJGI|TC78617 similar to UniRef100_A2Q4Y0 Cluster: F-box prot... 101 3e-21
gnl|LJGI|CB826878 similar to UniRef100_Q9BKD3 Cluster: TSO45-4B;... 100 1e-20
gnl|LJGI|TC79482 weakly similar to UniRef100_A7Q9Q9 Cluster: Chr... 80 1e-14
gnl|LJGI|TC79437 80 1e-14
gnl|LJGI|TC78296 80 1e-14
gnl|LJGI|TC73392 80 1e-14
gnl|LJGI|TC67010 weakly similar to UniRef100_A4UV34 Cluster: F-b... 78 4e-14
gnl|LJGI|TC59517 weakly similar to UniRef100_Q2HRF5 Cluster: Cyc... 74 7e-13
gnl|LJGI|DC598731 similar to UniRef100_Q2HS69 Cluster: Cyclin-li... 54 6e-07
gnl|LJGI|TC70961 52 3e-06
>gnl|LJGI|GO035798 weakly similar to UniRef100_Q12X80 Cluster: 4Fe-4S ferredoxin,
iron-sulfur binding; n=1; Methanococcoides burtonii DSM
6242|Rep: 4Fe-4S ferredoxin, iron-sulfur binding -
Methanococcoides burtonii (strain DSM 6242), partial
(10%)
Length = 581
Score = 565 bits (285), Expect = e-161
Identities = 288/289 (99%)
Strand = Plus / Plus
Query: 93 caggaaaacaggtaatttggttgtttggcaaatgaaggagtttggagtacacaagtcttg 152
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56 caggaaaacaggtaatttggttgtttggcaaatgaaggagtttggagtacacaagtcttg 115
Query: 153 gactcagttgttgaacattattttctatggaaaattcagtcaatggccctattttccgat 212
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 116 gactcagttgttgaacattattttctatggaaaattcagtcaatggccctattttccgat 175
Query: 213 gtgcatgtctgataatggtgatgccttgttgttgcaagattattgtgggtcccaagcagt 272
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 176 gtgcatgtctgataatggtgatgccttgttgttgcaagattattgtgggtcccaagcagt 235
Query: 273 tctctacaccctaaaagataataaaattgagagcacgatgatttctagcagcatcgctgg 332
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 236 tctctacaccctaaaagataataaaattgagagcacgatgatttctagcagcatcactgg 295
Query: 333 tttctatctcaatgactacattgaaagtttggtttcaccctgttgaaag 381
|||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 296 tttctatctcaatgactacattgaaagtttggtttcaccctgttgaaag 344
>gnl|LJGI|TC78617 similar to UniRef100_A2Q4Y0 Cluster: F-box protein interaction
domain; n=1; Medicago truncatula|Rep: F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (8%)
Length = 518
Score = 101 bits (51), Expect = 3e-21
Identities = 139/163 (85%), Gaps = 4/163 (2%)
Strand = Plus / Plus
Query: 118 tggcaaatgaaggagtttggagtacacaagtcttggactcagttgttgaacattattttc 177
||||||||||||||||||||||| ||| ||||||||||||| ||||| ||||||||| ||
Sbjct: 64 tggcaaatgaaggagtttggagtgcacgagtcttggactcaattgtttaacattattgtc 123
Query: 178 tatggaa-aattcagtcaatggccctattttccgatgtgcatgtctgataatggtgatgc 236
||| || ||||| ||| ||||| |||| | |||||||||||||| |||||||||||
Sbjct: 124 catgaaagaattc-ttcacacgccctgttttgctatgtgcatgtctgagaatggtgatgc 182
Query: 237 cttgttg-ttgcaagattattgtgggtcccaagcagttctcta 278
| ||||| |||||| | | | ||| ||||||||||||||||||
Sbjct: 183 cctgttgtttgcaa-aatctggtgtgtcccaagcagttctcta 224
>gnl|LJGI|CB826878 similar to UniRef100_Q9BKD3 Cluster: TSO45-4B; n=1; Taenia
solium|Rep: TSO45-4B - Taenia solium (Pork tapeworm),
partial (5%)
Length = 635
Score = 99.6 bits (50), Expect = 1e-20
Identities = 74/82 (90%)
Strand = Plus / Plus
Query: 89 atgacaggaaaacaggtaatttggttgtttggcaaatgaaggagtttggagtacacaagt 148
|||||| |||||| ||||||| || |||||||||||||||||||||||||| |||||||
Sbjct: 427 atgacaagaaaacccgtaattttgtggtttggcaaatgaaggagtttggagtgcacaagt 486
Query: 149 cttggactcagttgttgaacat 170
| |||||||||||||| |||||
Sbjct: 487 catggactcagttgttcaacat 508
>gnl|LJGI|TC79482 weakly similar to UniRef100_A7Q9Q9 Cluster: Chromosome chr5
scaffold_67, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr5 scaffold_67, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (10%)
Length = 551
Score = 79.8 bits (40), Expect = 1e-14
Identities = 76/88 (86%)
Strand = Plus / Plus
Query: 1 atgtttacaatatgggtgataaatgttggagaacaattcaagtttcccctcttccccgtt 60
|||||||||| ||||||||||| |||||||||||||||||| ||||||||| | ||| |
Sbjct: 397 atgtttacaacatgggtgataattgttggagaacaattcaaatttcccctcatgccccta 456
Query: 61 tgcgtcttagaggagctgcagtttatgt 88
||| ||| |||| |||||||||||||
Sbjct: 457 tgcatctccaaggatctgcagtttatgt 484
>gnl|LJGI|TC79437
Length = 744
Score = 79.8 bits (40), Expect = 1e-14
Identities = 132/160 (82%), Gaps = 2/160 (1%)
Strand = Plus / Plus
Query: 120 gcaaatgaaggagtttggagtacacaagtcttggactcagttgttgaacattattttcta 179
|||||||||||||| |||||| || |||| |||||||| ||||| ||||||||| || |
Sbjct: 169 gcaaatgaaggagtatggagtgaacgagtcatggactcaattgtttaacattattgtcca 228
Query: 180 tggaa-aattcagtcaatggccctattttccgatgtgcatgtctgataatggtgatgcct 238
|| || ||||| ||| | ||||| |||| | |||||||||||||| |||||||||| |
Sbjct: 229 tgcaagaattct-tcactcgccctgttttgctatgtgcatgtctgagaatggtgatgtcc 287
Query: 239 tgttgttgcaagattattgtgggtcccaagcagttctcta 278
||||||| ||| | | ||| ||||||||||||||||||
Sbjct: 288 tgttgtttgcagagtctggtgtgtcccaagcagttctcta 327
>gnl|LJGI|TC78296
Length = 551
Score = 79.8 bits (40), Expect = 1e-14
Identities = 132/160 (82%), Gaps = 2/160 (1%)
Strand = Plus / Plus
Query: 120 gcaaatgaaggagtttggagtacacaagtcttggactcagttgttgaacattattttcta 179
|||||||||||||| |||||| || |||| |||||||| ||||| ||||||||| || |
Sbjct: 124 gcaaatgaaggagtatggagtgaacgagtcatggactcaattgtttaacattattgtcca 183
Query: 180 tggaa-aattcagtcaatggccctattttccgatgtgcatgtctgataatggtgatgcct 238
|| || ||||| ||| | ||||| |||| | |||||||||||||| |||||||||| |
Sbjct: 184 tgaaagaattct-tcactcgccctgttttgctatgtgcatgtctgagaatggtgatgtcc 242
Query: 239 tgttgttgcaagattattgtgggtcccaagcagttctcta 278
||||||| ||| | | ||| ||||||||||||||||||
Sbjct: 243 tgttgtttgcagagtctggtgtgtcccaagcagttctcta 282
>gnl|LJGI|TC73392
Length = 647
Score = 79.8 bits (40), Expect = 1e-14
Identities = 76/88 (86%)
Strand = Plus / Plus
Query: 1 atgtttacaatatgggtgataaatgttggagaacaattcaagtttcccctcttccccgtt 60
|||||||||| ||||||||||| |||||||||||||||||| ||||||||| | ||| |
Sbjct: 433 atgtttacaacatgggtgataattgttggagaacaattcaaatttcccctcatgccccta 492
Query: 61 tgcgtcttagaggagctgcagtttatgt 88
||| ||| |||| |||||||||||||
Sbjct: 493 tgcatctccaaggatctgcagtttatgt 520
>gnl|LJGI|TC67010 weakly similar to UniRef100_A4UV34 Cluster: F-box domain-containing
protein; n=2; Solanum|Rep: F-box domain-containing
protein - Solanum tuberosum (Potato), partial (15%)
Length = 1074
Score = 77.8 bits (39), Expect = 4e-14
Identities = 75/87 (86%)
Strand = Plus / Plus
Query: 1 atgtttacaatatgggtgataaatgttggagaacaattcaagtttcccctcttccccgtt 60
|||||||||| ||||||||||| |||||||||||||||||| ||||||||| | ||| |
Sbjct: 568 atgtttacaacatgggtgataattgttggagaacaattcaaatttcccctcatgccccta 627
Query: 61 tgcgtcttagaggagctgcagtttatg 87
||| ||| |||| ||||||||||||
Sbjct: 628 tgcatctccaaggatctgcagtttatg 654
>gnl|LJGI|TC59517 weakly similar to UniRef100_Q2HRF5 Cluster: Cyclin-like F-box; n=1;
Medicago truncatula|Rep: Cyclin-like F-box - Medicago
truncatula (Barrel medic), partial (42%)
Length = 1382
Score = 73.8 bits (37), Expect = 7e-13
Identities = 46/49 (93%)
Strand = Plus / Plus
Query: 116 tttggcaaatgaaggagtttggagtacacaagtcttggactcagttgtt 164
||||||||||||| ||||||||||| ||||| |||||||||||||||||
Sbjct: 890 tttggcaaatgaaagagtttggagtgcacaattcttggactcagttgtt 938
>gnl|LJGI|DC598731 similar to UniRef100_Q2HS69 Cluster: Cyclin-like F-box; F-box
protein interaction domain; n=1; Medicago
truncatula|Rep: Cyclin-like F-box; F-box protein
interaction domain - Medicago truncatula (Barrel medic),
partial (14%)
Length = 592
Score = 54.0 bits (27), Expect = 6e-07
Identities = 30/31 (96%)
Strand = Plus / Plus
Query: 1 atgtttacaatatgggtgataaatgttggag 31
|||||||||| ||||||||||||||||||||
Sbjct: 559 atgtttacaacatgggtgataaatgttggag 589
>gnl|LJGI|TC70961
Length = 704
Score = 52.0 bits (26), Expect = 3e-06
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 115 gtttggcaaatgaaggagtttggagtacacaagtcttggactcagttgttgaacatta 172
|||||||||||| || |||| ||||||| ||||||||||||| |||||||| ||||
Sbjct: 283 gtttggcaaatggagaagttcggagtacgtgagtcttggactcaattgttgaaaatta 340