Miyakogusa Predicted Gene

Lj5g3v0803030.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0803030.1 Non Chatacterized Hit- tr|F1QAS2|F1QAS2_DANRE
Uncharacterized protein (Fragment) OS=Danio rerio PE=4,34.62,1.5,
,CUFF.53973.1
         (219 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67636                                                       90   6e-18

>gnl|LJGI|TC67636 
          Length = 732

 Score = 89.7 bits (45), Expect = 6e-18
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                       
Query: 9   aaaattaatctcttgcatccataaccatcttatccatcccgtcttcactcttgtggtgtg 68
           |||||||||||| ||||||||||||||||||||| ||||| ||||||||||||  |||||
Sbjct: 163 aaaattaatctcctgcatccataaccatcttatctatcccatcttcactcttgcagtgtg 104

                
Query: 69  ctcaa 73
           |||||
Sbjct: 103 ctcaa 99