Miyakogusa Predicted Gene

Lj5g3v0586790.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0586790.1 Non Chatacterized Hit- tr|I1MWG2|I1MWG2_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,88.46,0,ATPase_P-type: HAD ATPase, P-type, family IC,ATPase,
P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter; s,CUFF.53312.1
         (471 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80207 homologue to UniRef100_Q75N97 Cluster: Plasma m...   224   4e-58
gnl|LJGI|AU088926 similar to UniRef100_A7QRZ8 Cluster: Chromosom...    70   1e-11

>gnl|LJGI|TC80207 homologue to UniRef100_Q75N97 Cluster: Plasma membrane H+-ATPase;
           n=1; Daucus carota|Rep: Plasma membrane H+-ATPase -
           Daucus carota (Carrot), partial (24%)
          Length = 718

 Score =  224 bits (113), Expect = 4e-58
 Identities = 248/293 (84%)
 Strand = Plus / Plus

                                                                       
Query: 175 gaacacaaatatgaaattatcaagaggctgcaagagaggaagcatatatgtggaatgaca 234
           |||||||||||||||||  | |||||||||||||| |||||||| |||||||||||||||
Sbjct: 1   gaacacaaatatgaaatcgttaagaggctgcaagacaggaagcacatatgtggaatgaca 60

                                                                       
Query: 235 ggagatggtgttgatgatgtccctgcattgaagaaagcggatattggaatagctgttgct 294
           || ||||||||  | |||| ||||||||| |||| ||| ||||||||||| |||||||| 
Sbjct: 61  ggtgatggtgtcaacgatgcccctgcattaaagagagcagatattggaattgctgttgca 120

                                                                       
Query: 295 gatgctacagatgctgctagaagtgcttctgatattgtcctcactgaccatggtttaaga 354
           || |||||||| |||||||||||||||||||| |||||||||||||| | |||  | || 
Sbjct: 121 gacgctacagacgctgctagaagtgcttctgacattgtcctcactgaacctgggctgagt 180

                                                                       
Query: 355 gtgattattagtgtagtgataaccagtagggagattcttcagaggatgaagaattatact 414
           || |||||||||| |||| | ||||| |||| |||| | || |||||||| || || || 
Sbjct: 181 gtcattattagtgcagtgctcaccagcagggcgattttccaaaggatgaaaaactacacg 240

                                                                
Query: 415 atttatgccgtgtcaatcactattcatatggtgtttggtttcttatttattgc 467
           || ||||| ||||||||||| |||| ||| ||||| |||||| | ||||||||
Sbjct: 241 atctatgctgtgtcaatcaccattcgtatagtgttcggtttcatgtttattgc 293


>gnl|LJGI|AU088926 similar to UniRef100_A7QRZ8 Cluster: Chromosome undetermined
           scaffold_155, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_155,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (17%)
          Length = 487

 Score = 69.9 bits (35), Expect = 1e-11
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 139 attgagaaggctgatggatttgcagtagtttttccggaacacaaatatgaaattatcaag 198
           ||||||||||||||||||||||||| ||| || || |||||||| | ||| ||| | || 
Sbjct: 245 attgagaaggctgatggatttgcaggagtcttccctgaacacaagtntgagattgtgaan 304

                                                          
Query: 199 aggctgcaagagaggaagcatatatgtggaatgacaggagatggtgt 245
           ||| |||| || |  ||||| || ||||||||||| ||| |||||||
Sbjct: 305 aggttgcangatacaaagcacatttgtggaatgaccgganatggtgt 351