Miyakogusa Predicted Gene

Lj5g3v0586780.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0586780.1 Non Chatacterized Hit- tr|I1MWG2|I1MWG2_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,90.91,0,Calcium
ATPase, transmembrane domain M,NULL; HAD-like,HAD-like domain;
E1-E2_ATPase,ATPase, P-type, ,CUFF.53311.1
         (364 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC79757 homologue to UniRef100_Q7Y068 Cluster: Plasma m...   252   1e-66
gnl|LJGI|TC74406 homologue to UniRef100_Q4VCL8 Cluster: Plasma m...    98   5e-20
gnl|LJGI|TC60156 homologue to UniRef100_Q4VCL9 Cluster: Plasma m...    82   3e-15

>gnl|LJGI|TC79757 homologue to UniRef100_Q7Y068 Cluster: Plasma membrane H+-ATPase;
           n=2; Sesbania rostrata|Rep: Plasma membrane H+-ATPase -
           Sesbania rostrata, partial (21%)
          Length = 586

 Score =  252 bits (127), Expect = 1e-66
 Identities = 175/191 (91%)
 Strand = Plus / Plus

                                                                       
Query: 163 gctattgaggaaatggcagggatggacgtcctctgcagtgataaaaccgggactctcact 222
           |||||||||||||||||||||||||| |||||||||||||| ||||| |||||||| || 
Sbjct: 1   gctattgaggaaatggcagggatggatgtcctctgcagtgacaaaactgggactctgacc 60

                                                                       
Query: 223 ttgaataagctatgtgttgatagaaacttgattgaagtctttgccaagggtgttgagaag 282
            ||||||||||  |||||||||||||||||||||| || ||| |||||||| ||||||||
Sbjct: 61  ctgaataagctgagtgttgatagaaacttgattgaggtttttaccaagggtattgagaag 120

                                                                       
Query: 283 gagcatgttatcctgctagcagctagagcttctaggactgaaaatcaggatgccatagat 342
           |||||||||||||| || ||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 121 gagcatgttatccttcttgcagcaagagcttctaggactgagaatcaggatgccatagat 180

                      
Query: 343 gctgcaattgt 353
           |||||||||||
Sbjct: 181 gctgcaattgt 191


>gnl|LJGI|TC74406 homologue to UniRef100_Q4VCL8 Cluster: Plasma membrane H+ ATPase;
           n=1; Lupinus albus|Rep: Plasma membrane H+ ATPase -
           Lupinus albus (White lupin), partial (20%)
          Length = 573

 Score = 97.6 bits (49), Expect = 5e-20
 Identities = 268/341 (78%)
 Strand = Plus / Plus

                                                                       
Query: 13  cagcaccgcaagtacagggatggaattgacaatcttttagtgctattgattgggggaatt 72
           |||||||| ||||||||| | |||||||||||  | || || ||||||||||| ||||||
Sbjct: 157 cagcaccggaagtacaggaacggaattgacaacttgttggtcctattgattggaggaatt 216

                                                                       
Query: 73  ccccattccatgccaactgttttgtttgtcactatggctattggttcgcacagtttttcc 132
           |||  | ||||||| ||||| |||| ||| || ||||| |||||||| ||||   |  | 
Sbjct: 217 cccattgccatgcctactgtgttgtctgtgacaatggccattggttctcacaagctagct 276

                                                                       
Query: 133 ctgcaaggtgcgattatgaaacgaatgacagctattgaggaaatggcagggatggacgtc 192
           | ||||||||| || |  ||  ||||||| || || ||||||||||| || ||||| |||
Sbjct: 277 cagcaaggtgccatcaccaagagaatgactgccatagaggaaatggctggcatggatgtc 336

                                                                       
Query: 193 ctctgcagtgataaaaccgggactctcactttgaataagctatgtgttgatagaaacttg 252
           || |||||||| || || || || |||||  | || || ||   |||||| |  ||||||
Sbjct: 337 ctttgcagtgacaagacaggaacactcacccttaacaaactcactgttgacaagaacttg 396

                                                                       
Query: 253 attgaagtctttgccaagggtgttgagaaggagcatgttatcctgctagcagctagagct 312
            |||| |||||||| || || || || ||||| || || ||||| || || || || |||
Sbjct: 397 gttgaggtctttgcgaaaggagtggacaaggaccacgtgatccttcttgctgcaagggct 456

                                                    
Query: 313 tctaggactgaaaatcaggatgccatagatgctgcaattgt 353
            ||||||||||||| |||||||||||||||||||| |||||
Sbjct: 457 gctaggactgaaaaccaggatgccatagatgctgccattgt 497


>gnl|LJGI|TC60156 homologue to UniRef100_Q4VCL9 Cluster: Plasma membrane H+ ATPase;
            n=1; Lupinus albus|Rep: Plasma membrane H+ ATPase -
            Lupinus albus (White lupin), partial (32%)
          Length = 1093

 Score = 81.8 bits (41), Expect = 3e-15
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgtatccgatacagcaccgcaagtacagggatggaattgacaatcttttagtgctattg 60
            ||||| || ||||| || ||||||||||| ||||| |||||||||||  | || ||||||
Sbjct: 958  atgtacccaatacaacatcgcaagtacagagatgggattgacaatctgctggttctattg 1017

                                                                        
Query: 61   attgggggaattccccattccatgccaactgttttgtttgtcactatggctattggttcg 120
            ||||| ||||||||   | ||||||| |||||||||| ||| || ||||||||||| || 
Sbjct: 1018 attggaggaattccgattgccatgcctactgttttgtctgttaccatggctattggctct 1077

                 
Query: 121  cacag 125
            |||||
Sbjct: 1078 cacag 1082