Miyakogusa Predicted Gene

Lj5g3v0539520.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0539520.1 Non Chatacterized Hit- tr|C0JP24|C0JP24_LOTJA
Putative basic helix-loop-helix protein BHLH6 OS=Lotus,46.67,0.000007,
,CUFF.53236.1
         (373 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO018918 UniRef100_Q6J9H4 Cluster: SET binding protein ...    74   7e-13

>gnl|LJGI|GO018918 UniRef100_Q6J9H4 Cluster: SET binding protein 1; n=1; Gorilla
           gorilla|Rep: SET binding protein 1 - Gorilla gorilla
           (gorilla), partial (5%)
          Length = 600

 Score = 73.8 bits (37), Expect = 7e-13
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 241 ttcacgagggcaacgaaagcgtggttattgggaaaatccgtaggattacgctatcctggg 300
           ||||| |||||||| || || ||||||||||| ||||| |  ||  | || ||||| |||
Sbjct: 317 ttcaccagggcaacaaaggcatggttattgggtaaatcagctggtcttcgttatccgggg 376

                                                                
Query: 301 agtgatgaagaagccataaggggattagctgaggaattggaagaagacagacc 353
           | |||||| ||||| |||||||| || || |||||||||||||||||||||||
Sbjct: 377 actgatgaggaagcaataaggggcttggcagaggaattggaagaagacagacc 429