Miyakogusa Predicted Gene

Lj5g3v0529040.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0529040.1 Non Chatacterized Hit- tr|I3S8G1|I3S8G1_LOTJA
Uncharacterized protein OS=Lotus japonicus PE=2
SV=1,70.18,0.000000000000005, ,CUFF.53201.1
         (169 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC61366 similar to UniRef100_A7PM86 Cluster: Chromosome...   159   6e-39

>gnl|LJGI|TC61366 similar to UniRef100_A7PM86 Cluster: Chromosome chr14 scaffold_21,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr14 scaffold_21, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (97%)
          Length = 806

 Score =  159 bits (80), Expect = 6e-39
 Identities = 92/96 (95%)
 Strand = Plus / Plus

                                                                       
Query: 10  gtgactcgggtaatgctgggagtgaacgagtcaagcttgaggggttacccttacccttcc 69
           ||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||||
Sbjct: 74  gtgactcggataatgctgggagtgaacgagtcaagcttgaagggttaccctcacccttcc 133

                                               
Query: 70  attagcagcaaaggcgctttcgaatggaccatcaac 105
           ||||||||||||||||||||||| ||||||||||||
Sbjct: 134 attagcagcaaaggcgctttcgagtggaccatcaac 169



 Score = 58.0 bits (29), Expect = 2e-08
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                
Query: 101 tcaaccttctctttctccatgttcaggttcctgatga 137
           |||||||||||||| |||||||||| |||||||||||
Sbjct: 198 tcaaccttctctttgtccatgttcaagttcctgatga 234