Miyakogusa Predicted Gene

Lj5g3v0523180.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0523180.1 tr|B9MY55|B9MY55_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_594536 PE=4
SV=1,50.93,0.000000000000009,PRA1,Prenylated rab acceptor
PRA1,gene.g59033.t1.1
         (372 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80437 weakly similar to UniRef100_A6EZN4 Cluster: Pre...    58   4e-08

>gnl|LJGI|TC80437 weakly similar to UniRef100_A6EZN4 Cluster: Predicted membrane
           protein; n=1; Marinobacter algicola DG893|Rep: Predicted
           membrane protein - Marinobacter algicola DG893, partial
           (11%)
          Length = 644

 Score = 58.0 bits (29), Expect = 4e-08
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 97  aactctgttttgcttcatagaagcgttgataaaaggtttgtgttcggtttactagtattt 156
           |||||||||||||||||||| | | ||||||| |||||||||||  |||| || | | ||
Sbjct: 289 aactctgttttgcttcataggatcattgataagaggtttgtgttgtgtttgcttgcaatt 348

                                        
Query: 157 gcaacactagtgcagctgattttgactga 185
           |||||    ||||||||| ||||||||||
Sbjct: 349 gcaacttctgtgcagctggttttgactga 377