Miyakogusa Predicted Gene

Lj5g3v0445880.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0445880.1 Non Chatacterized Hit- tr|I1M836|I1M836_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.2261
PE=,51.79,0.00000004, ,CUFF.53000.1
         (264 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69928 homologue to UniRef100_Q0S384 Cluster: ABC Fe(3...   377   e-104
gnl|LJGI|TC72023 similar to UniRef100_Q9M3V1 Cluster: Protein ph...    58   3e-08
gnl|LJGI|TC71409 similar to UniRef100_Q9M3V1 Cluster: Protein ph...    58   3e-08

>gnl|LJGI|TC69928 homologue to UniRef100_Q0S384 Cluster: ABC Fe(3+)-transporter,
           ATP-binding component; n=1; Rhodococcus sp. RHA1|Rep:
           ABC Fe(3+)-transporter, ATP-binding component -
           Rhodococcus sp. (strain RHA1), partial (5%)
          Length = 538

 Score =  377 bits (190), Expect = e-104
 Identities = 246/264 (93%), Gaps = 3/264 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtgcaaggagaggctgcatgagattgcgaaggaggttaactttgtgccagatcagaat 60
           |||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||
Sbjct: 20  atgtgcaaggagaggctgcatgagattgcgaaggaggttaactttgtgccaga---gaat 76

                                                                       
Query: 61  tcggagtggaagaacacgatgaagcaagggttcatttgtatggacgatgaggttcaggga 120
             |||||||||||||||| |||||||| |||||||||| | |||||||||||||||||||
Sbjct: 77  gtggagtggaagaacacgttgaagcaaaggttcatttgcagggacgatgaggttcaggga 136

                                                                       
Query: 121 tggaagagccatatcaatgaaaccacctgcagatgcgagctctggacctctcagcacaac 180
           ||||||||  ||||||| |||||||||||||||||||||||||||||| |||||| ||||
Sbjct: 137 tggaagagttatatcaacgaaaccacctgcagatgcgagctctggacccctcagcgcaac 196

                                                                       
Query: 181 tggtgtattatcattcctattgtccttgtgagaatatatgagatagatgagattctcaaa 240
           || |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||
Sbjct: 197 tgttgtattatcattcctattgtccttttgagaatatatgagatggatgagattctcaaa 256

                                   
Query: 241 ttgagcaagttaaggtttatcccc 264
           |||||||||||| |||||||||||
Sbjct: 257 ttgagcaagttagggtttatcccc 280


>gnl|LJGI|TC72023 similar to UniRef100_Q9M3V1 Cluster: Protein phpsphatase 2C; n=1;
           Fagus sylvatica|Rep: Protein phpsphatase 2C - Fagus
           sylvatica (Beechnut), partial (25%)
          Length = 574

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 75  cacgatgaagcaagggttcatttgtatggacgatgaggttcagggatggaagagcca 131
           ||||||||||||||| |||  | | |||||||||||||||||| |||||| ||||||
Sbjct: 359 cacgatgaagcaaggcttcgctcgcatggacgatgaggttcagagatggacgagcca 415


>gnl|LJGI|TC71409 similar to UniRef100_Q9M3V1 Cluster: Protein phpsphatase 2C; n=1;
           Fagus sylvatica|Rep: Protein phpsphatase 2C - Fagus
           sylvatica (Beechnut), partial (24%)
          Length = 812

 Score = 58.0 bits (29), Expect = 3e-08
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 75  cacgatgaagcaagggttcatttgtatggacgatgaggttcagggatggaagagcca 131
           ||||||||||||||| |||  | | |||||||||||||||||| |||||| ||||||
Sbjct: 689 cacgatgaagcaaggcttcgctcgcatggacgatgaggttcagagatggacgagcca 745