Miyakogusa Predicted Gene
- Lj5g3v0404890.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v0404890.1 tr|Q6VM17|Q6VM17_MEDTR Metal transport protein
OS=Medicago truncatula GN=ZIP5 PE=2 SV=1,73.73,0,zip: ZIP zinc/iron
transport family,Zinc/iron permease, fungal/plant; Zip,Zinc/iron
permease; ZINC/I,CUFF.52949.1
(1200 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC76224 similar to UniRef100_Q93XE7 Cluster: ZIP-like z... 131 1e-29
gnl|LJGI|BP084096 homologue to UniRef100_Q6VM17 Cluster: Metal t... 98 2e-19
gnl|LJGI|TC81513 homologue to UniRef100_Q8LE59 Cluster: Fe(2+) t... 68 1e-10
gnl|LJGI|GO034035 similar to UniRef100_Q2Z1Q1 Cluster: ZIP famil... 56 5e-07
>gnl|LJGI|TC76224 similar to UniRef100_Q93XE7 Cluster: ZIP-like zinc transporter; n=1;
Thlaspi caerulescens|Rep: ZIP-like zinc transporter -
Thlaspi caerulescens (Alpine penny-cress) (Thlaspi
calaminare), partial (30%)
Length = 452
Score = 131 bits (66), Expect = 1e-29
Identities = 129/150 (86%)
Strand = Plus / Plus
Query: 1022 cagaaggcatcttggacgcgttctcagctgggatcttagtgtacatggctctggtggatt 1081
||||||| || |||||| |||| ||||| ||||| ||||||||||||||| | ||||| |
Sbjct: 220 cagaagggattttggactcgttgtcagcagggattttagtgtacatggctttagtggact 279
Query: 1082 taatagctgcggattttcttagcaagagaatgcgttgtgactttaggctgcagatagttt 1141
| |||||||| |||||||| ||||| |||||| ||||| | |||||||||||||||||||
Sbjct: 280 tgatagctgctgattttctcagcaaaagaatgagttgtaattttaggctgcagatagttt 339
Query: 1142 catactgtttgcttttccttggagctggat 1171
| || || ||||||||||||| |||||||
Sbjct: 340 cttattgcatgcttttccttggtgctggat 369
>gnl|LJGI|BP084096 homologue to UniRef100_Q6VM17 Cluster: Metal transport protein; n=1;
Medicago truncatula|Rep: Metal transport protein -
Medicago, partial (4%)
Length = 122
Score = 97.6 bits (49), Expect = 2e-19
Identities = 52/53 (98%)
Strand = Plus / Minus
Query: 1148 gtttgcttttccttggagctggatcgatgtcttcactagcaatgtgggcatga 1200
|||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 122 gtttgcttttccttggagctggatcgatgtcttcactagccatgtgggcatga 70
>gnl|LJGI|TC81513 homologue to UniRef100_Q8LE59 Cluster: Fe(2+) transport protein 3,
chloroplast precursor (Fe(II) transport protein 3); n=1;
Arabidopsis thaliana|Rep: Fe(2+) transport protein 3,
chloroplast precursor (Fe(II) transport protein 3) -
Arabidopsis thaliana (Mouse-ear cress), partial (11%)
Length = 260
Score = 67.9 bits (34), Expect = 1e-10
Identities = 67/78 (85%)
Strand = Plus / Plus
Query: 1123 tttaggctgcagatagtttcatactgtttgcttttccttggagctggatcgatgtcttca 1182
|||||||||||||||||||| || || ||||||||||||| ||||||| ||||| ||
Sbjct: 60 tttaggctgcagatagtttcttattgcatgcttttccttggtgctggattaatgtcctcg 119
Query: 1183 ctagcaatgtgggcatga 1200
|| ||||| |||||||||
Sbjct: 120 cttgcaatatgggcatga 137
>gnl|LJGI|GO034035 similar to UniRef100_Q2Z1Q1 Cluster: ZIP family metal transporter;
n=1; Chengiopanax sciadophylloides|Rep: ZIP family metal
transporter - Acanthopanax sciadophylloides
(Koshiabura), partial (11%)
Length = 210
Score = 56.0 bits (28), Expect = 5e-07
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 727 cacgtcgtcgtttcacaggttttggaacttgggattgtatcaca 770
||||| || ||||||||||| ||||| |||||||||||||||||
Sbjct: 165 cacgttgttgtttcacaggtcttggagcttgggattgtatcaca 208