Miyakogusa Predicted Gene

Lj5g3v0290430.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0290430.1 Non Chatacterized Hit- tr|A5B8Y6|A5B8Y6_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,64.62,0.000000000000002,(Trans)glycosidases,Glycoside hydrolase,
superfamily; Glycosyl hydrolase domain,NULL; Alpha-amylase
,CUFF.52731.1
         (621 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS341165 weakly similar to UniRef100_P17859 Cluster: Al...   218   3e-56
gnl|LJGI|FS329665 similar to UniRef100_P17859 Cluster: Alpha-amy...    60   2e-08

>gnl|LJGI|FS341165 weakly similar to UniRef100_P17859 Cluster: Alpha-amylase
           precursor; n=1; Vigna mungo|Rep: Alpha-amylase precursor
           - Vigna mungo (Rice bean) (Black gram), partial (40%)
          Length = 692

 Score =  218 bits (110), Expect = 3e-56
 Identities = 110/110 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggttgttgggtatgctccaaggttcaccaaaatctacatggagaaaacctcacctgat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 583 atggttgttgggtatgctccaaggttcaccaaaatctacatggagaaaacctcacctgat 642

                                                             
Query: 61  tttgcagttggggagctttatcagaatgtaacaagaggacaagatggaag 110
           ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 643 tttgcagttggggagctttatcagaatgtaacaagaggacaagatggaag 692


>gnl|LJGI|FS329665 similar to UniRef100_P17859 Cluster: Alpha-amylase precursor; n=1;
           Vigna mungo|Rep: Alpha-amylase precursor - Vigna mungo
           (Rice bean) (Black gram), partial (58%)
          Length = 733

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 31  aaaatctacatggagaaaacctcacctgattttgcagt 68
           ||||| |||||||||||||| |||||||||||||||||
Sbjct: 629 aaaatttacatggagaaaacttcacctgattttgcagt 666