Miyakogusa Predicted Gene

Lj5g3v0290410.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0290410.1 Non Chatacterized Hit- tr|I1M8M3|I1M8M3_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,84.57,0,EP450I,Cytochrome P450, E-class, group I; P450,Cytochrome
P450; no description,Cytochrome P450; Cyto,CUFF.52720.1
         (1431 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77933 similar to UniRef100_Q0H212 Cluster: Abscisic a...    82   1e-14
gnl|LJGI|TC74875 similar to UniRef100_Q0H212 Cluster: Abscisic a...    68   2e-10

>gnl|LJGI|TC77933 similar to UniRef100_Q0H212 Cluster: Abscisic acid 8'-hydroxylase;
            n=1; Phaseolus vulgaris|Rep: Abscisic acid 8'-hydroxylase
            - Phaseolus vulgaris (Kidney bean) (French bean), partial
            (23%)
          Length = 551

 Score = 81.8 bits (41), Expect = 1e-14
 Identities = 134/165 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1108 ataccaaaagggtggaaagcaatgcctctgttcaggaatattcatcacaatccagaattt 1167
            ||||||||||||||||||| | | ||||| ||||| || || ||||||| || ||||  |
Sbjct: 25   ataccaaaagggtggaaagtattacctcttttcagaaacatacatcacagtctagaaaat 84

                                                                        
Query: 1168 tttccagaggctcataaattcaacccttcaaggtttgaggtggcaccaaaacccaacact 1227
            | | ||||  || | |||||  | |||||||| |||||||| || |||||||||||||||
Sbjct: 85   tatacagatcctgagaaatttgatccttcaagatttgaggttgctccaaaacccaacact 144

                                                         
Query: 1228 ttcatgccatttggtagtggagtacatgcatgccccggcaatgag 1272
            || ||||||||||| | |||  | |||||||| || |||||||||
Sbjct: 145  tttatgccatttggcactgggatccatgcatgtccaggcaatgag 189


>gnl|LJGI|TC74875 similar to UniRef100_Q0H212 Cluster: Abscisic acid 8'-hydroxylase;
           n=1; Phaseolus vulgaris|Rep: Abscisic acid
           8'-hydroxylase - Phaseolus vulgaris (Kidney bean)
           (French bean), complete
          Length = 1790

 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 118/146 (80%)
 Strand = Plus / Plus

                                                                       
Query: 145 tacataggacagaccttccaactctactcccaagacccaaatgttttctttttcaccaaa 204
           ||||||||| | ||||||||| | || || |||||||||||||| ||||||  | | |||
Sbjct: 187 tacataggagaaaccttccaaatgtattctcaagacccaaatgtcttctttgcctcaaaa 246

                                                                       
Query: 205 cagaaaaggtatggtgaaatattcaagaccaacattcttggttgtccctgtgtgatgctt 264
              |||||||||||    || |||||| || ||||| | ||||||||||| |||||| ||
Sbjct: 247 atcaaaaggtatggctctatgttcaagtcccacattttgggttgtccctgcgtgatgatt 306

                                     
Query: 265 gcaagccctgaggctgcaaggtttgt 290
            |||||||||| ||||||| ||||||
Sbjct: 307 tcaagccctgaagctgcaaagtttgt 332



 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 1201 tttgaggtggcaccaaaacccaacactttcatgccatttggtagtgg 1247
            |||||||| || ||||||||||| || |||||||||||||| |||||
Sbjct: 1225 tttgaggttgctccaaaacccaatacattcatgccatttggcagtgg 1271