Miyakogusa Predicted Gene
- Lj5g3v0290410.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v0290410.1 Non Chatacterized Hit- tr|I1M8M3|I1M8M3_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,84.57,0,EP450I,Cytochrome P450, E-class, group I; P450,Cytochrome
P450; no description,Cytochrome P450; Cyto,CUFF.52720.1
(1431 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC77933 similar to UniRef100_Q0H212 Cluster: Abscisic a... 82 1e-14
gnl|LJGI|TC74875 similar to UniRef100_Q0H212 Cluster: Abscisic a... 68 2e-10
>gnl|LJGI|TC77933 similar to UniRef100_Q0H212 Cluster: Abscisic acid 8'-hydroxylase;
n=1; Phaseolus vulgaris|Rep: Abscisic acid 8'-hydroxylase
- Phaseolus vulgaris (Kidney bean) (French bean), partial
(23%)
Length = 551
Score = 81.8 bits (41), Expect = 1e-14
Identities = 134/165 (81%)
Strand = Plus / Plus
Query: 1108 ataccaaaagggtggaaagcaatgcctctgttcaggaatattcatcacaatccagaattt 1167
||||||||||||||||||| | | ||||| ||||| || || ||||||| || |||| |
Sbjct: 25 ataccaaaagggtggaaagtattacctcttttcagaaacatacatcacagtctagaaaat 84
Query: 1168 tttccagaggctcataaattcaacccttcaaggtttgaggtggcaccaaaacccaacact 1227
| | |||| || | ||||| | |||||||| |||||||| || |||||||||||||||
Sbjct: 85 tatacagatcctgagaaatttgatccttcaagatttgaggttgctccaaaacccaacact 144
Query: 1228 ttcatgccatttggtagtggagtacatgcatgccccggcaatgag 1272
|| ||||||||||| | ||| | |||||||| || |||||||||
Sbjct: 145 tttatgccatttggcactgggatccatgcatgtccaggcaatgag 189
>gnl|LJGI|TC74875 similar to UniRef100_Q0H212 Cluster: Abscisic acid 8'-hydroxylase;
n=1; Phaseolus vulgaris|Rep: Abscisic acid
8'-hydroxylase - Phaseolus vulgaris (Kidney bean)
(French bean), complete
Length = 1790
Score = 67.9 bits (34), Expect = 2e-10
Identities = 118/146 (80%)
Strand = Plus / Plus
Query: 145 tacataggacagaccttccaactctactcccaagacccaaatgttttctttttcaccaaa 204
||||||||| | ||||||||| | || || |||||||||||||| |||||| | | |||
Sbjct: 187 tacataggagaaaccttccaaatgtattctcaagacccaaatgtcttctttgcctcaaaa 246
Query: 205 cagaaaaggtatggtgaaatattcaagaccaacattcttggttgtccctgtgtgatgctt 264
||||||||||| || |||||| || ||||| | ||||||||||| |||||| ||
Sbjct: 247 atcaaaaggtatggctctatgttcaagtcccacattttgggttgtccctgcgtgatgatt 306
Query: 265 gcaagccctgaggctgcaaggtttgt 290
|||||||||| ||||||| ||||||
Sbjct: 307 tcaagccctgaagctgcaaagtttgt 332
Score = 54.0 bits (27), Expect = 2e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 1201 tttgaggtggcaccaaaacccaacactttcatgccatttggtagtgg 1247
|||||||| || ||||||||||| || |||||||||||||| |||||
Sbjct: 1225 tttgaggttgctccaaaacccaatacattcatgccatttggcagtgg 1271