Miyakogusa Predicted Gene
- Lj5g3v0255600.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v0255600.1 tr|G7I8E2|G7I8E2_MEDTR Calcium-dependent protein
kinase OS=Medicago truncatula GN=MTR_1g026190 PE=4
,73.27,0,Pkinase,Protein kinase, catalytic domain;
PROTEIN_KINASE_ATP,Protein kinase, ATP binding site;
PROTE,CUFF.52684.1
(727 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC67919 similar to UniRef100_O24431 Cluster: Calmodulin... 94 1e-18
gnl|LJGI|GO023453 homologue to UniRef100_Q84P28 Cluster: Seed ca... 60 2e-08
gnl|LJGI|TC75325 homologue to UniRef100_Q84P29 Cluster: Seed cal... 54 1e-06
gnl|LJGI|GO025742 similar to UniRef100_Q5XLG3 Cluster: Calcium-d... 52 5e-06
gnl|LJGI|TC65144 homologue to UniRef100_Q5XLG3 Cluster: Calcium-... 52 5e-06
>gnl|LJGI|TC67919 similar to UniRef100_O24431 Cluster: Calmodulin-like domain protein
kinase isoenzyme gamma; n=1; Glycine max|Rep:
Calmodulin-like domain protein kinase isoenzyme gamma -
Glycine max (Soybean), partial (38%)
Length = 1155
Score = 93.7 bits (47), Expect = 1e-18
Identities = 227/287 (79%)
Strand = Plus / Plus
Query: 430 caacccaacatcgttgagttcaagggtgcttatgaggaccggcagagcgtgcatttggtg 489
||||| ||||| ||||||||||| |||||||||||||| ||| || ||| | |||
Sbjct: 706 caacctaacattgttgagttcaaaggtgcttatgaggataagcaatcggttcatgttgtg 765
Query: 490 atggagttgtgttatggtggtgagctttttgataggatcaccgcaaagggtagttactct 549
|||||| | ||| ||||||||||||||||||||||||| || ||||| |||| |
Sbjct: 766 atggagctatgtgcaggtggtgagctttttgataggatcattgccaaggggcattacagt 825
Query: 550 gagcgtgaagctgcttccacattcaggcaaattgtgaatgtggttcatgcttgtcatttt 609
|| | | |||||||| | || ||| |||||||| ||||| ||||||| || |||||
Sbjct: 826 gaaagggccgctgcttcaatatgcagacaaattgttaatgttgttcatgtctgccatttc 885
Query: 610 atgggggtgatgcatagggacctcaagccagagaatttcttgatggttagtaaggatgat 669
||||| |||||||||||||| || ||||||||||||||||| | ||| ||||||||
Sbjct: 886 atgggtgtgatgcatagggatctgaagccagagaatttcttattatctagcaaggatgaa 945
Query: 670 aaggcacctttgaaagccaccgattttggattgtccgtcttcattga 716
|| |||| | | || ||||| |||||||| ||||| || ||||||||
Sbjct: 946 aaagcacttctcaaggccacggattttggcttgtctgttttcattga 992
>gnl|LJGI|GO023453 homologue to UniRef100_Q84P28 Cluster: Seed calcium dependent
protein kinase b; n=1; Glycine max|Rep: Seed calcium
dependent protein kinase b - Glycine max (Soybean),
partial (36%)
Length = 588
Score = 60.0 bits (30), Expect = 2e-08
Identities = 45/50 (90%)
Strand = Plus / Plus
Query: 478 gtgcatttggtgatggagttgtgttatggtggtgagctttttgataggat 527
||||||||||| |||||| | ||| ||||||||||||||||||||||||
Sbjct: 317 gtgcatttggtcatggagctttgtgctggtggtgagctttttgataggat 366
>gnl|LJGI|TC75325 homologue to UniRef100_Q84P29 Cluster: Seed calcium dependent
protein kinase a; n=1; Glycine max|Rep: Seed calcium
dependent protein kinase a - Glycine max (Soybean),
partial (63%)
Length = 1121
Score = 54.0 bits (27), Expect = 1e-06
Identities = 33/35 (94%)
Strand = Plus / Plus
Query: 613 ggggtgatgcatagggacctcaagccagagaattt 647
||||| |||||||||||||||||||| ||||||||
Sbjct: 590 ggggttatgcatagggacctcaagcctgagaattt 624
>gnl|LJGI|GO025742 similar to UniRef100_Q5XLG3 Cluster: Calcium-dependent protein
kinase 1; n=1; Vicia faba|Rep: Calcium-dependent protein
kinase 1 - Vicia faba (Broad bean), partial (39%)
Length = 749
Score = 52.0 bits (26), Expect = 5e-06
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 598 gcttgtcattttatgggggtgatgcatagggacctcaagccagagaatttcttg 651
|||||||||| | | ||||| |||||||| ||||| ||||| ||||||||||||
Sbjct: 529 gcttgtcattctcttggggttatgcatagagaccttaagcctgagaatttcttg 582
>gnl|LJGI|TC65144 homologue to UniRef100_Q5XLG3 Cluster: Calcium-dependent protein
kinase 1; n=1; Vicia faba|Rep: Calcium-dependent protein
kinase 1 - Vicia faba (Broad bean), partial (94%)
Length = 1699
Score = 52.0 bits (26), Expect = 5e-06
Identities = 47/54 (87%)
Strand = Plus / Plus
Query: 598 gcttgtcattttatgggggtgatgcatagggacctcaagccagagaatttcttg 651
|||||||||| | | ||||| |||||||| ||||| ||||| ||||||||||||
Sbjct: 547 gcttgtcattctcttggggttatgcatagagaccttaagcctgagaatttcttg 600