Miyakogusa Predicted Gene

Lj5g3v0255600.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0255600.1 tr|G7I8E2|G7I8E2_MEDTR Calcium-dependent protein
kinase OS=Medicago truncatula GN=MTR_1g026190 PE=4
,73.27,0,Pkinase,Protein kinase, catalytic domain;
PROTEIN_KINASE_ATP,Protein kinase, ATP binding site;
PROTE,CUFF.52684.1
         (727 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67919 similar to UniRef100_O24431 Cluster: Calmodulin...    94   1e-18
gnl|LJGI|GO023453 homologue to UniRef100_Q84P28 Cluster: Seed ca...    60   2e-08
gnl|LJGI|TC75325 homologue to UniRef100_Q84P29 Cluster: Seed cal...    54   1e-06
gnl|LJGI|GO025742 similar to UniRef100_Q5XLG3 Cluster: Calcium-d...    52   5e-06
gnl|LJGI|TC65144 homologue to UniRef100_Q5XLG3 Cluster: Calcium-...    52   5e-06

>gnl|LJGI|TC67919 similar to UniRef100_O24431 Cluster: Calmodulin-like domain protein
           kinase isoenzyme gamma; n=1; Glycine max|Rep:
           Calmodulin-like domain protein kinase isoenzyme gamma -
           Glycine max (Soybean), partial (38%)
          Length = 1155

 Score = 93.7 bits (47), Expect = 1e-18
 Identities = 227/287 (79%)
 Strand = Plus / Plus

                                                                       
Query: 430 caacccaacatcgttgagttcaagggtgcttatgaggaccggcagagcgtgcatttggtg 489
           ||||| ||||| ||||||||||| ||||||||||||||   |||    || ||| | |||
Sbjct: 706 caacctaacattgttgagttcaaaggtgcttatgaggataagcaatcggttcatgttgtg 765

                                                                       
Query: 490 atggagttgtgttatggtggtgagctttttgataggatcaccgcaaagggtagttactct 549
           |||||| | |||   |||||||||||||||||||||||||  || |||||   ||||  |
Sbjct: 766 atggagctatgtgcaggtggtgagctttttgataggatcattgccaaggggcattacagt 825

                                                                       
Query: 550 gagcgtgaagctgcttccacattcaggcaaattgtgaatgtggttcatgcttgtcatttt 609
           ||  | |  |||||||| | || ||| |||||||| ||||| |||||||  || ||||| 
Sbjct: 826 gaaagggccgctgcttcaatatgcagacaaattgttaatgttgttcatgtctgccatttc 885

                                                                       
Query: 610 atgggggtgatgcatagggacctcaagccagagaatttcttgatggttagtaaggatgat 669
           ||||| |||||||||||||| || |||||||||||||||||  |   ||| |||||||| 
Sbjct: 886 atgggtgtgatgcatagggatctgaagccagagaatttcttattatctagcaaggatgaa 945

                                                          
Query: 670 aaggcacctttgaaagccaccgattttggattgtccgtcttcattga 716
           || |||| | | || ||||| |||||||| ||||| || ||||||||
Sbjct: 946 aaagcacttctcaaggccacggattttggcttgtctgttttcattga 992


>gnl|LJGI|GO023453 homologue to UniRef100_Q84P28 Cluster: Seed calcium dependent
           protein kinase b; n=1; Glycine max|Rep: Seed calcium
           dependent protein kinase b - Glycine max (Soybean),
           partial (36%)
          Length = 588

 Score = 60.0 bits (30), Expect = 2e-08
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 478 gtgcatttggtgatggagttgtgttatggtggtgagctttttgataggat 527
           ||||||||||| |||||| | |||  ||||||||||||||||||||||||
Sbjct: 317 gtgcatttggtcatggagctttgtgctggtggtgagctttttgataggat 366


>gnl|LJGI|TC75325 homologue to UniRef100_Q84P29 Cluster: Seed calcium dependent
           protein kinase a; n=1; Glycine max|Rep: Seed calcium
           dependent protein kinase a - Glycine max (Soybean),
           partial (63%)
          Length = 1121

 Score = 54.0 bits (27), Expect = 1e-06
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 613 ggggtgatgcatagggacctcaagccagagaattt 647
           ||||| |||||||||||||||||||| ||||||||
Sbjct: 590 ggggttatgcatagggacctcaagcctgagaattt 624


>gnl|LJGI|GO025742 similar to UniRef100_Q5XLG3 Cluster: Calcium-dependent protein
           kinase 1; n=1; Vicia faba|Rep: Calcium-dependent protein
           kinase 1 - Vicia faba (Broad bean), partial (39%)
          Length = 749

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 598 gcttgtcattttatgggggtgatgcatagggacctcaagccagagaatttcttg 651
           |||||||||| | | ||||| |||||||| ||||| ||||| ||||||||||||
Sbjct: 529 gcttgtcattctcttggggttatgcatagagaccttaagcctgagaatttcttg 582


>gnl|LJGI|TC65144 homologue to UniRef100_Q5XLG3 Cluster: Calcium-dependent protein
           kinase 1; n=1; Vicia faba|Rep: Calcium-dependent protein
           kinase 1 - Vicia faba (Broad bean), partial (94%)
          Length = 1699

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 598 gcttgtcattttatgggggtgatgcatagggacctcaagccagagaatttcttg 651
           |||||||||| | | ||||| |||||||| ||||| ||||| ||||||||||||
Sbjct: 547 gcttgtcattctcttggggttatgcatagagaccttaagcctgagaatttcttg 600