Miyakogusa Predicted Gene

Lj5g3v0244330.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0244330.1 Non Chatacterized Hit- tr|I1MC15|I1MC15_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.53487
PE,83.8,0,PEROXIDASE_4,Haem peroxidase, plant/fungal/bacterial;
PLPEROXIDASE,Plant peroxidase; PEROXIDASE,Haem,CUFF.52668.1
         (963 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64999 similar to UniRef100_Q9ZRG5 Cluster: Peroxidase...   184   7e-46
gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase...    60   3e-08
gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase...    58   1e-07
gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic p...    54   2e-06
gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic p...    54   2e-06

>gnl|LJGI|TC64999 similar to UniRef100_Q9ZRG5 Cluster: Peroxidase; n=1; Glycine
           max|Rep: Peroxidase - Glycine max (Soybean), partial
           (71%)
          Length = 726

 Score =  184 bits (93), Expect = 7e-46
 Identities = 306/377 (81%)
 Strand = Plus / Plus

                                                                       
Query: 154 gacaaaactgtccctgctgctctgcttcgcatgcattttcatgattgcttcataaggggt 213
           ||||||||||||||||| || || ||  | ||||| || ||||| ||||||||  |||| 
Sbjct: 190 gacaaaactgtccctgcagcacttctgaggatgcacttccatgactgcttcattcgggga 249

                                                                       
Query: 214 tgtgatgcctctgttctgctggaatcaaagggaaagaacaaagcagaaaaagatgggcct 273
           |||||||||||||| ||| |  | ||||| ||||  ||||||||||| |||||||| || 
Sbjct: 250 tgtgatgcctctgtgctgttaaactcaaaaggaagcaacaaagcagagaaagatggacca 309

                                                                       
Query: 274 cctaacatttctttgcatgcattctatgtcattgacaatgctaagaaagcagtagaagct 333
           || ||  |||||||||||||||||| |||||||||   ||| ||||||||||||||||||
Sbjct: 310 ccaaatgtttctttgcatgcattctttgtcattgatggtgcaaagaaagcagtagaagct 369

                                                                       
Query: 334 gtttgccctggtgttgtatcttgtgctgatattgtggctcttgctgctagggacgctgtt 393
           |  ||||||||||| || || |||||||||||  | ||||| || || |||||||| || 
Sbjct: 370 gcatgccctggtgtggtctcctgtgctgatatcctagctctagcagcaagggacgcagta 429

                                                                       
Query: 394 acactgtctggagggcccacttgggaagtaccaaaaggaagaaaggatggtagaatatca 453
              ||||||||||| || | |||||| ||||| ||||||||||||||||| |||| ||| 
Sbjct: 430 tttctgtctggaggtccaagttgggatgtacctaaaggaagaaaggatggaagaaaatcc 489

                                                                       
Query: 454 aaggccactgaaaccagacaattgccagctcctactttcaacatctcccaattgcaacaa 513
            |||||| |||||||| |||| | ||||| || || |||||||| || ||| | ||  | 
Sbjct: 490 caggccagtgaaaccacacaactaccagcaccaaccttcaacatatcacaactacagaag 549

                            
Query: 514 agcttttctcaaagagg 530
           ||||| |||||||||||
Sbjct: 550 agcttctctcaaagagg 566


>gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase 5; n=1; Phaseolus
           vulgaris|Rep: Peroxidase 5 - Phaseolus vulgaris (Kidney
           bean) (French bean), partial (93%)
          Length = 1309

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 30/30 (100%)
 Strand = Plus / Plus

                                         
Query: 337 tgccctggtgttgtatcttgtgctgatatt 366
           ||||||||||||||||||||||||||||||
Sbjct: 410 tgccctggtgttgtatcttgtgctgatatt 439


>gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase 71 precursor; n=1;
           Arabidopsis thaliana|Rep: Peroxidase 71 precursor -
           Arabidopsis thaliana (Mouse-ear cress), partial (65%)
          Length = 1340

 Score = 58.0 bits (29), Expect = 1e-07
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 337 tgccctggtgttgtatcttgtgctgatattgtggctcttgctgct 381
           |||||||||||||| || |||||||||||| | ||||||||||||
Sbjct: 427 tgccctggtgttgtgtcctgtgctgatattcttgctcttgctgct 471


>gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
           Stylosanthes humilis|Rep: Cationic peroxidase -
           Stylosanthes humilis (Townsville stylo), partial (95%)
          Length = 1291

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 337 tgccctggtgttgtatcttgtgctgatattgtggctcttgctgctag 383
           |||||||||||||| |||||||||||||| || ||| | ||||||||
Sbjct: 436 tgccctggtgttgtctcttgtgctgatatcgttgctgtagctgctag 482


>gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
           precursor; n=1; Arachis hypogaea|Rep: Cationic
           peroxidase 1 precursor - Arachis hypogaea (Peanut),
           partial (81%)
          Length = 896

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 337 tgccctggtgttgtatcttgtgctgatattgtggctcttgctgctag 383
           |||||||||||||| |||||||||||||| || ||| | ||||||||
Sbjct: 155 tgccctggtgttgtctcttgtgctgatatcgttgctgtagctgctag 201