Miyakogusa Predicted Gene
- Lj5g3v0244330.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v0244330.1 Non Chatacterized Hit- tr|I1MC15|I1MC15_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.53487
PE,83.8,0,PEROXIDASE_4,Haem peroxidase, plant/fungal/bacterial;
PLPEROXIDASE,Plant peroxidase; PEROXIDASE,Haem,CUFF.52668.1
(963 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64999 similar to UniRef100_Q9ZRG5 Cluster: Peroxidase... 184 7e-46
gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase... 60 3e-08
gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase... 58 1e-07
gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic p... 54 2e-06
gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic p... 54 2e-06
>gnl|LJGI|TC64999 similar to UniRef100_Q9ZRG5 Cluster: Peroxidase; n=1; Glycine
max|Rep: Peroxidase - Glycine max (Soybean), partial
(71%)
Length = 726
Score = 184 bits (93), Expect = 7e-46
Identities = 306/377 (81%)
Strand = Plus / Plus
Query: 154 gacaaaactgtccctgctgctctgcttcgcatgcattttcatgattgcttcataaggggt 213
||||||||||||||||| || || || | ||||| || ||||| |||||||| ||||
Sbjct: 190 gacaaaactgtccctgcagcacttctgaggatgcacttccatgactgcttcattcgggga 249
Query: 214 tgtgatgcctctgttctgctggaatcaaagggaaagaacaaagcagaaaaagatgggcct 273
|||||||||||||| ||| | | ||||| |||| ||||||||||| |||||||| ||
Sbjct: 250 tgtgatgcctctgtgctgttaaactcaaaaggaagcaacaaagcagagaaagatggacca 309
Query: 274 cctaacatttctttgcatgcattctatgtcattgacaatgctaagaaagcagtagaagct 333
|| || |||||||||||||||||| ||||||||| ||| ||||||||||||||||||
Sbjct: 310 ccaaatgtttctttgcatgcattctttgtcattgatggtgcaaagaaagcagtagaagct 369
Query: 334 gtttgccctggtgttgtatcttgtgctgatattgtggctcttgctgctagggacgctgtt 393
| ||||||||||| || || ||||||||||| | ||||| || || |||||||| ||
Sbjct: 370 gcatgccctggtgtggtctcctgtgctgatatcctagctctagcagcaagggacgcagta 429
Query: 394 acactgtctggagggcccacttgggaagtaccaaaaggaagaaaggatggtagaatatca 453
||||||||||| || | |||||| ||||| ||||||||||||||||| |||| |||
Sbjct: 430 tttctgtctggaggtccaagttgggatgtacctaaaggaagaaaggatggaagaaaatcc 489
Query: 454 aaggccactgaaaccagacaattgccagctcctactttcaacatctcccaattgcaacaa 513
|||||| |||||||| |||| | ||||| || || |||||||| || ||| | || |
Sbjct: 490 caggccagtgaaaccacacaactaccagcaccaaccttcaacatatcacaactacagaag 549
Query: 514 agcttttctcaaagagg 530
||||| |||||||||||
Sbjct: 550 agcttctctcaaagagg 566
>gnl|LJGI|TC61166 similar to UniRef100_Q9XFL6 Cluster: Peroxidase 5; n=1; Phaseolus
vulgaris|Rep: Peroxidase 5 - Phaseolus vulgaris (Kidney
bean) (French bean), partial (93%)
Length = 1309
Score = 60.0 bits (30), Expect = 3e-08
Identities = 30/30 (100%)
Strand = Plus / Plus
Query: 337 tgccctggtgttgtatcttgtgctgatatt 366
||||||||||||||||||||||||||||||
Sbjct: 410 tgccctggtgttgtatcttgtgctgatatt 439
>gnl|LJGI|TC61108 similar to UniRef100_Q43387 Cluster: Peroxidase 71 precursor; n=1;
Arabidopsis thaliana|Rep: Peroxidase 71 precursor -
Arabidopsis thaliana (Mouse-ear cress), partial (65%)
Length = 1340
Score = 58.0 bits (29), Expect = 1e-07
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 337 tgccctggtgttgtatcttgtgctgatattgtggctcttgctgct 381
|||||||||||||| || |||||||||||| | ||||||||||||
Sbjct: 427 tgccctggtgttgtgtcctgtgctgatattcttgctcttgctgct 471
>gnl|LJGI|TC80986 similar to UniRef100_Q41324 Cluster: Cationic peroxidase; n=1;
Stylosanthes humilis|Rep: Cationic peroxidase -
Stylosanthes humilis (Townsville stylo), partial (95%)
Length = 1291
Score = 54.0 bits (27), Expect = 2e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 337 tgccctggtgttgtatcttgtgctgatattgtggctcttgctgctag 383
|||||||||||||| |||||||||||||| || ||| | ||||||||
Sbjct: 436 tgccctggtgttgtctcttgtgctgatatcgttgctgtagctgctag 482
>gnl|LJGI|TC62405 similar to UniRef100_P22195 Cluster: Cationic peroxidase 1
precursor; n=1; Arachis hypogaea|Rep: Cationic
peroxidase 1 precursor - Arachis hypogaea (Peanut),
partial (81%)
Length = 896
Score = 54.0 bits (27), Expect = 2e-06
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 337 tgccctggtgttgtatcttgtgctgatattgtggctcttgctgctag 383
|||||||||||||| |||||||||||||| || ||| | ||||||||
Sbjct: 155 tgccctggtgttgtctcttgtgctgatatcgttgctgtagctgctag 201