Miyakogusa Predicted Gene
- Lj5g3v0110950.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v0110950.1 tr|A2Q3R6|A2Q3R6_MEDTR Poly(ADP-ribose)
polymerase, catalytic region OS=Medicago truncatula
GN=MTR_7,58.57,6e-18,seg,NULL; SUBFAMILY NOT NAMED,NULL; FAMILY NOT
NAMED,NULL; PARP_CATALYTIC,Poly(ADP-ribose) polymeras,CUFF.52590.1
(417 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC64658 weakly similar to UniRef100_A7PC37 Cluster: Chr... 96 2e-19
>gnl|LJGI|TC64658 weakly similar to UniRef100_A7PC37 Cluster: Chromosome chr2
scaffold_11, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr2 scaffold_11, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (40%)
Length = 1685
Score = 95.6 bits (48), Expect = 2e-19
Identities = 93/108 (86%)
Strand = Plus / Plus
Query: 73 tatgataatggggtggatgacatccaatgcccaagatactatacaatatggaatatgaat 132
||||||| ||||||||||||||| || | || |||||||||| | | ||||| ||||||
Sbjct: 669 tatgatagtggggtggatgacattgaaagtccgagatactatatagtgtggaacatgaat 728
Query: 133 ataaacactcacatctatccagaatttgttattagtttcaaggtttct 180
| ||||| ||||||||||||||||| ||| |||||||||||||||||
Sbjct: 729 gtgaacacccacatctatccagaattcgttgttagtttcaaggtttct 776
Score = 61.9 bits (31), Expect = 3e-09
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 341 tccgagatctccttggctgcctttttctatgcttgttgctgctatta 387
||||||||| |||||| |||||||| |||||||| ||||||||||||
Sbjct: 926 tccgagatccccttggatgccttttcctatgctttttgctgctatta 972