Miyakogusa Predicted Gene

Lj5g3v0109830.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0109830.1 Non Chatacterized Hit- tr|C6TIX1|C6TIX1_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.8100 PE=,69.7,1e-17,Acid
proteases,Peptidase aspartic; BASIC 7S GLOBULIN-RELATED,NULL; ASPARTYL
PROTEASES,Peptidase A1; ,gene.g58400.t1.1
         (192 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC69329 weakly similar to UniRef100_Q3KU27 Cluster: Nec...   202   5e-52
gnl|LJGI|BP077472 weakly similar to UniRef100_Q05929 Cluster: ED...    54   3e-07
gnl|LJGI|TC74495 weakly similar to UniRef100_A7PSD5 Cluster: Chr...    54   3e-07

>gnl|LJGI|TC69329 weakly similar to UniRef100_Q3KU27 Cluster: Nectarin IV; n=1;
            Nicotiana langsdorffii x Nicotiana sanderae|Rep: Nectarin
            IV - Nicotiana langsdorffii x Nicotiana sanderae
            (Ornamental tobacco), partial (34%)
          Length = 1479

 Score =  202 bits (102), Expect = 5e-52
 Identities = 159/178 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1    atggtgttggtaaagaaaaatgtagcatgcctcggattcgtggatggtgggaaagaggca 60
            ||||||||||||||  |||| ||||||||||||||||| ||||||||||||||   ||||
Sbjct: 1145 atggtgttggtaaatgaaaaagtagcatgcctcggatttgtggatggtgggaagacggca 1204

                                                                        
Query: 61   atggcagcagttgttattggtgggcaccagttggaggacaaccttctggagtttgatttg 120
            | | | ||||||||||||||||||||||||||||||||||||||| |||| |||||||| 
Sbjct: 1205 aggactgcagttgttattggtgggcaccagttggaggacaaccttgtggaatttgattta 1264

                                                                      
Query: 121  gcttcctccaaacttggcttcacctcttccctcctccttcaccatgcaagatgttccc 178
            | |||||||||||| ||||||| ||||||||||||||||||  |||||| ||||||||
Sbjct: 1265 ggttcctccaaactgggcttcagctcttccctcctccttcaaaatgcaacatgttccc 1322


>gnl|LJGI|BP077472 weakly similar to UniRef100_Q05929 Cluster: EDGP precursor; n=1;
           Daucus carota|Rep: EDGP precursor - Daucus carota
           (Carrot), partial (8%)
          Length = 406

 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 71  ttgttattggtgggcaccagttggaggacaaccttctggagtttgatttgg 121
           ||||| |||||||||| ||||||||||| ||  || |||||||||||||||
Sbjct: 307 ttgttcttggtgggcatcagttggaggataattttttggagtttgatttgg 257


>gnl|LJGI|TC74495 weakly similar to UniRef100_A7PSD5 Cluster: Chromosome chr14
           scaffold_27, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr14 scaffold_27, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (20%)
          Length = 874

 Score = 54.0 bits (27), Expect = 3e-07
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 71  ttgttattggtgggcaccagttggaggacaaccttctggagtttgatttgg 121
           ||||| |||||||||| ||||||||||| ||  || |||||||||||||||
Sbjct: 677 ttgttcttggtgggcatcagttggaggataattttttggagtttgatttgg 727