Miyakogusa Predicted Gene

Lj5g3v0102650.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v0102650.1 Non Chatacterized Hit- tr|B9R7T5|B9R7T5_RICCO
Putative uncharacterized protein OS=Ricinus communis
G,42.31,3.9,seg,NULL,CUFF.52648.1
         (372 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC58158                                                      226   8e-59
gnl|LJGI|TC64609                                                       96   2e-19
gnl|LJGI|TC69260 similar to UniRef100_A7Q983 Cluster: Chromosome...    64   6e-10
gnl|LJGI|TC67778                                                       64   6e-10
gnl|LJGI|TC65246                                                       64   6e-10
gnl|LJGI|FS331511                                                      56   2e-07
gnl|LJGI|TC66567 UniRef100_Q6UJ71 Cluster: NBS-LRR resistance ge...    56   2e-07
gnl|LJGI|TC60397                                                       56   2e-07

>gnl|LJGI|TC58158 
          Length = 1266

 Score =  226 bits (114), Expect = 8e-59
 Identities = 140/151 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgatggctagggtttgtttgttattcgacctttgccatgtcaggagcgcttgcatggca 60
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 365 atgatggctagggtttgtttgttattcgacctttgccatgtcaggtgcgcttgcatggca 424

                                                                       
Query: 61  gggcaaaaataccttaataaaattgaaatttattgtgttgagggggagagacatgggttt 120
           || ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 425 ggtcaaaaataccttaataaaattgatatttattgtgttgagggggagagacatggtttt 484

                                          
Query: 121 ggggcnnnnnnngtgtatttgcccagccaag 151
           |||||       |||||||||||||||||||
Sbjct: 485 ggggctttttttgtgtatttgcccagccaag 515



 Score =  180 bits (91), Expect = 4e-45
 Identities = 91/91 (100%)
 Strand = Plus / Plus

                                                                       
Query: 235 attattgtttactccgttctagtgcgtgacacacatgtgaatcggtcatcgatttggaac 294
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 599 attattgtttactccgttctagtgcgtgacacacatgtgaatcggtcatcgatttggaac 658

                                          
Query: 295 ctgactgactgcgatgagctacacgctgcga 325
           |||||||||||||||||||||||||||||||
Sbjct: 659 ctgactgactgcgatgagctacacgctgcga 689


>gnl|LJGI|TC64609 
          Length = 873

 Score = 95.6 bits (48), Expect = 2e-19
 Identities = 48/48 (100%)
 Strand = Plus / Plus

                                                           
Query: 325 actagtcatcaacgactatgccggtatggtgctcttttagtttgattg 372
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 74  actagtcatcaacgactatgccggtatggtgctcttttagtttgattg 121


>gnl|LJGI|TC69260 similar to UniRef100_A7Q983 Cluster: Chromosome chr19 scaffold_66,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr19 scaffold_66, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (8%)
          Length = 1136

 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 27  cgacctttgccatgtcaggagcgcttgcatggcagg 62
           ||||||||||||||||||| ||||||||||||||||
Sbjct: 480 cgacctttgccatgtcaggtgcgcttgcatggcagg 515


>gnl|LJGI|TC67778 
          Length = 1010

 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 27  cgacctttgccatgtcaggagcgcttgcatggcagg 62
           ||||||||||||||||||| ||||||||||||||||
Sbjct: 565 cgacctttgccatgtcaggtgcgcttgcatggcagg 600


>gnl|LJGI|TC65246 
          Length = 906

 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 27  cgacctttgccatgtcaggagcgcttgcatggcagg 62
           ||||||||||||||||||| ||||||||||||||||
Sbjct: 481 cgacctttgccatgtcaggtgcgcttgcatggcagg 516


>gnl|LJGI|FS331511 
          Length = 742

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 27  cgacctttgccatgtcaggagcgcttgcatggcagg 62
           ||||||||||||||||||| |||||||| |||||||
Sbjct: 519 cgacctttgccatgtcaggtgcgcttgcttggcagg 554


>gnl|LJGI|TC66567 UniRef100_Q6UJ71 Cluster: NBS-LRR resistance gene-like protein
           ARGH08; n=1; Malus x domestica|Rep: NBS-LRR resistance
           gene-like protein ARGH08 - Malus domestica (Apple)
           (Malus sylvestris), partial (8%)
          Length = 664

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 27  cgacctttgccatgtcaggagcgcttgcatggcagg 62
           ||||||||||||||||||| |||||||| |||||||
Sbjct: 530 cgacctttgccatgtcaggtgcgcttgcttggcagg 565


>gnl|LJGI|TC60397 
          Length = 1767

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 27  cgacctttgccatgtcaggagcgcttgcatggcagg 62
           ||||||||||||||||||| |||||||| |||||||
Sbjct: 408 cgacctttgccatgtcaggtgcgcttgcttggcagg 443