Miyakogusa Predicted Gene
- Lj5g3v0102650.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v0102650.1 Non Chatacterized Hit- tr|B9R7T5|B9R7T5_RICCO
Putative uncharacterized protein OS=Ricinus communis
G,42.31,3.9,seg,NULL,CUFF.52648.1
(372 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC58158 226 8e-59
gnl|LJGI|TC64609 96 2e-19
gnl|LJGI|TC69260 similar to UniRef100_A7Q983 Cluster: Chromosome... 64 6e-10
gnl|LJGI|TC67778 64 6e-10
gnl|LJGI|TC65246 64 6e-10
gnl|LJGI|FS331511 56 2e-07
gnl|LJGI|TC66567 UniRef100_Q6UJ71 Cluster: NBS-LRR resistance ge... 56 2e-07
gnl|LJGI|TC60397 56 2e-07
>gnl|LJGI|TC58158
Length = 1266
Score = 226 bits (114), Expect = 8e-59
Identities = 140/151 (92%)
Strand = Plus / Plus
Query: 1 atgatggctagggtttgtttgttattcgacctttgccatgtcaggagcgcttgcatggca 60
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 365 atgatggctagggtttgtttgttattcgacctttgccatgtcaggtgcgcttgcatggca 424
Query: 61 gggcaaaaataccttaataaaattgaaatttattgtgttgagggggagagacatgggttt 120
|| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 425 ggtcaaaaataccttaataaaattgatatttattgtgttgagggggagagacatggtttt 484
Query: 121 ggggcnnnnnnngtgtatttgcccagccaag 151
||||| |||||||||||||||||||
Sbjct: 485 ggggctttttttgtgtatttgcccagccaag 515
Score = 180 bits (91), Expect = 4e-45
Identities = 91/91 (100%)
Strand = Plus / Plus
Query: 235 attattgtttactccgttctagtgcgtgacacacatgtgaatcggtcatcgatttggaac 294
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 599 attattgtttactccgttctagtgcgtgacacacatgtgaatcggtcatcgatttggaac 658
Query: 295 ctgactgactgcgatgagctacacgctgcga 325
|||||||||||||||||||||||||||||||
Sbjct: 659 ctgactgactgcgatgagctacacgctgcga 689
>gnl|LJGI|TC64609
Length = 873
Score = 95.6 bits (48), Expect = 2e-19
Identities = 48/48 (100%)
Strand = Plus / Plus
Query: 325 actagtcatcaacgactatgccggtatggtgctcttttagtttgattg 372
||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 74 actagtcatcaacgactatgccggtatggtgctcttttagtttgattg 121
>gnl|LJGI|TC69260 similar to UniRef100_A7Q983 Cluster: Chromosome chr19 scaffold_66,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr19 scaffold_66, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (8%)
Length = 1136
Score = 63.9 bits (32), Expect = 6e-10
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 27 cgacctttgccatgtcaggagcgcttgcatggcagg 62
||||||||||||||||||| ||||||||||||||||
Sbjct: 480 cgacctttgccatgtcaggtgcgcttgcatggcagg 515
>gnl|LJGI|TC67778
Length = 1010
Score = 63.9 bits (32), Expect = 6e-10
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 27 cgacctttgccatgtcaggagcgcttgcatggcagg 62
||||||||||||||||||| ||||||||||||||||
Sbjct: 565 cgacctttgccatgtcaggtgcgcttgcatggcagg 600
>gnl|LJGI|TC65246
Length = 906
Score = 63.9 bits (32), Expect = 6e-10
Identities = 35/36 (97%)
Strand = Plus / Plus
Query: 27 cgacctttgccatgtcaggagcgcttgcatggcagg 62
||||||||||||||||||| ||||||||||||||||
Sbjct: 481 cgacctttgccatgtcaggtgcgcttgcatggcagg 516
>gnl|LJGI|FS331511
Length = 742
Score = 56.0 bits (28), Expect = 2e-07
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 27 cgacctttgccatgtcaggagcgcttgcatggcagg 62
||||||||||||||||||| |||||||| |||||||
Sbjct: 519 cgacctttgccatgtcaggtgcgcttgcttggcagg 554
>gnl|LJGI|TC66567 UniRef100_Q6UJ71 Cluster: NBS-LRR resistance gene-like protein
ARGH08; n=1; Malus x domestica|Rep: NBS-LRR resistance
gene-like protein ARGH08 - Malus domestica (Apple)
(Malus sylvestris), partial (8%)
Length = 664
Score = 56.0 bits (28), Expect = 2e-07
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 27 cgacctttgccatgtcaggagcgcttgcatggcagg 62
||||||||||||||||||| |||||||| |||||||
Sbjct: 530 cgacctttgccatgtcaggtgcgcttgcttggcagg 565
>gnl|LJGI|TC60397
Length = 1767
Score = 56.0 bits (28), Expect = 2e-07
Identities = 34/36 (94%)
Strand = Plus / Plus
Query: 27 cgacctttgccatgtcaggagcgcttgcatggcagg 62
||||||||||||||||||| |||||||| |||||||
Sbjct: 408 cgacctttgccatgtcaggtgcgcttgcttggcagg 443