Miyakogusa Predicted Gene

Lj4g3v3115160.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v3115160.1 Non Chatacterized Hit- tr|I1KQM0|I1KQM0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.1651
PE=,41.94,0.000000002,seg,NULL,CUFF.52419.1
         (345 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO018652 similar to UniRef100_Q93X83 Cluster: Hsp70 int...   220   4e-57
gnl|LJGI|FS331502 similar to UniRef100_Q8VZH4 Cluster: Tetratric...   218   2e-56
gnl|LJGI|TC59595 similar to UniRef100_Q8VZH4 Cluster: Tetratrico...   218   2e-56

>gnl|LJGI|GO018652 similar to UniRef100_Q93X83 Cluster: Hsp70 interacting
           protein/thioredoxin chimera; n=1; Vitis labrusca|Rep:
           Hsp70 interacting protein/thioredoxin chimera - Vitis
           labrusca, partial (38%)
          Length = 625

 Score =  220 bits (111), Expect = 4e-57
 Identities = 111/111 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatggggcgaaagtaagagagctgaagcaactggtggaggcatgcaagtcaaatcct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 45  atggatggggcgaaagtaagagagctgaagcaactggtggaggcatgcaagtcaaatcct 104

                                                              
Query: 61  tcacttctccacaacccttctctttccttcttcaagtcttatcttctcagg 111
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 105 tcacttctccacaacccttctctttccttcttcaagtcttatcttctcagg 155


>gnl|LJGI|FS331502 similar to UniRef100_Q8VZH4 Cluster: Tetratricoredoxin; n=1;
           Nicotiana tabacum|Rep: Tetratricoredoxin - Nicotiana
           tabacum (Common tobacco), partial (39%)
          Length = 703

 Score =  218 bits (110), Expect = 2e-56
 Identities = 110/110 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatggggcgaaagtaagagagctgaagcaactggtggaggcatgcaagtcaaatcct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 34  atggatggggcgaaagtaagagagctgaagcaactggtggaggcatgcaagtcaaatcct 93

                                                             
Query: 61  tcacttctccacaacccttctctttccttcttcaagtcttatcttctcag 110
           ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 94  tcacttctccacaacccttctctttccttcttcaagtcttatcttctcag 143



 Score = 73.8 bits (37), Expect = 6e-13
 Identities = 37/37 (100%)
 Strand = Plus / Plus

                                                
Query: 244 agcctaggtgctcgcatcccgatccaacctaaaacgg 280
           |||||||||||||||||||||||||||||||||||||
Sbjct: 142 agcctaggtgctcgcatcccgatccaacctaaaacgg 178


>gnl|LJGI|TC59595 similar to UniRef100_Q8VZH4 Cluster: Tetratricoredoxin; n=1;
           Nicotiana tabacum|Rep: Tetratricoredoxin - Nicotiana
           tabacum (Common tobacco), partial (52%)
          Length = 798

 Score =  218 bits (110), Expect = 2e-56
 Identities = 110/110 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggatggggcgaaagtaagagagctgaagcaactggtggaggcatgcaagtcaaatcct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 47  atggatggggcgaaagtaagagagctgaagcaactggtggaggcatgcaagtcaaatcct 106

                                                             
Query: 61  tcacttctccacaacccttctctttccttcttcaagtcttatcttctcag 110
           ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 107 tcacttctccacaacccttctctttccttcttcaagtcttatcttctcag 156



 Score = 73.8 bits (37), Expect = 6e-13
 Identities = 37/37 (100%)
 Strand = Plus / Plus

                                                
Query: 244 agcctaggtgctcgcatcccgatccaacctaaaacgg 280
           |||||||||||||||||||||||||||||||||||||
Sbjct: 155 agcctaggtgctcgcatcccgatccaacctaaaacgg 191