Miyakogusa Predicted Gene

Lj4g3v3115140.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v3115140.1 tr|D3GE74|D3GE74_MEDTR ABC transporter G family
member OS=Medicago truncatula GN=STR PE=2 SV=1,87.06,0,seg,NULL;
ABC2_membrane,ABC-2 type transporter; ABC_tran,ABC transporter-like;
ABC_TRANSPORTER_2,ABC,CUFF.52417.1
         (2646 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO012322 similar to UniRef100_A9YWR6 Cluster: ABC trans...    62   2e-08

>gnl|LJGI|GO012322 similar to UniRef100_A9YWR6 Cluster: ABC transporter; n=1; Medicago
            truncatula|Rep: ABC transporter - Medicago truncatula
            (Barrel medic), partial (29%)
          Length = 646

 Score = 61.9 bits (31), Expect = 2e-08
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1952 ttttcttttcttccaatgatgcagtcccatcttttatcatggaaaggttcatcttcatca 2011
            ||||||| |||||||||||||| |||||  | || |||   || ||||||||||||||| 
Sbjct: 342  ttttcttctcttccaatgatgccgtcccggccttcatccaagagaggttcatcttcatcc 401

                               
Query: 2012 gggagacttcacacaatgc 2030
            | |||||||||||||||||
Sbjct: 402  gcgagacttcacacaatgc 420