Miyakogusa Predicted Gene
- Lj4g3v3114840.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v3114840.1 Non Chatacterized Hit- tr|I1K5C2|I1K5C2_SOYBN
Uncharacterized protein OS=Glycine max PE=3
SV=1,96.51,7.9874e-44,Tubulin nucleotide-binding
domain-like,Tubulin/FtsZ, GTPase domain; TUBULIN,Tubulin;
Tubulin,Tubulin,FS346488.path2.1
(259 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS346488 similar to UniRef100_Q2TFP1 Cluster: Tubulin B... 450 e-126
gnl|LJGI|TC72323 homologue to UniRef100_A7QIU1 Cluster: Chromoso... 92 2e-18
gnl|LJGI|TC63392 homologue to UniRef100_Q2TFP1 Cluster: Tubulin ... 66 1e-10
gnl|LJGI|BW621317 homologue to UniRef100_Q6VAF4 Cluster: Tubulin... 64 4e-10
gnl|LJGI|TC62547 homologue to UniRef100_P37392 Cluster: Tubulin ... 64 4e-10
gnl|LJGI|DC594743 homologue to UniRef100_A7QXE9 Cluster: Chromos... 62 2e-09
>gnl|LJGI|FS346488 similar to UniRef100_Q2TFP1 Cluster: Tubulin B4; n=1; Glycine
max|Rep: Tubulin B4 - Glycine max (Soybean), partial
(19%)
Length = 632
Score = 450 bits (227), Expect = e-126
Identities = 251/259 (96%)
Strand = Plus / Plus
Query: 1 atgcgtgagattcttcacattcagggagggcagtgtgggaaccagataggatcaaagttc 60
|||||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 373 atgcgtgaaattcttcacattcagggagggcagtgggggaaccaaataggatcaaagttc 432
Query: 61 tgggaagtggtgtgtgacgagcatgggattgaccccatagggcagtacgtagggaactca 120
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 433 tgggaagtggtgtgtgacaagcatgggattgaccccatagggcagtacgtagggaactca 492
Query: 121 gaacttcaacttgaaagagtgaatgtttattacaacgagggcagcaatggacgttacgtg 180
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 493 aaacttcaacttgaaaaagtgaatgtttattacaacgagggcagcaatggacgttacgtg 552
Query: 181 ccacgggcagtgctgatggaccttgagcctggcaccatggatgctgtccggaccggccct 240
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 553 ccacgggcagtgctgatggaccttgaccctggcaccatggatgctgtccggaccggccct 612
Query: 241 tatggccagattttccggc 259
|||||||| ||||||||||
Sbjct: 613 tatggccaaattttccggc 631
>gnl|LJGI|TC72323 homologue to UniRef100_A7QIU1 Cluster: Chromosome chr2
scaffold_105, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr2 scaffold_105, whole genome
shotgun sequence - Vitis vinifera (Grape), complete
Length = 1703
Score = 91.7 bits (46), Expect = 2e-18
Identities = 67/74 (90%)
Strand = Plus / Plus
Query: 1 atgcgtgagattcttcacattcagggagggcagtgtgggaaccagataggatcaaagttc 60
|||||||||||||||||||| |||||||| || || ||||||||||| ||| ||||||||
Sbjct: 121 atgcgtgagattcttcacatccagggaggacaatgcgggaaccagatcggagcaaagttc 180
Query: 61 tgggaagtggtgtg 74
||||| ||||||||
Sbjct: 181 tgggaggtggtgtg 194
>gnl|LJGI|TC63392 homologue to UniRef100_Q2TFP1 Cluster: Tubulin B4; n=1; Glycine
max|Rep: Tubulin B4 - Glycine max (Soybean), partial
(82%)
Length = 1176
Score = 65.9 bits (33), Expect = 1e-10
Identities = 66/77 (85%)
Strand = Plus / Plus
Query: 7 gagattcttcacattcagggagggcagtgtgggaaccagataggatcaaagttctgggaa 66
||||| |||||||||||||| || || || ||||||||||| || || |||||||||||
Sbjct: 78 gagatccttcacattcagggtggacaatgcgggaaccagatcggttcgaagttctgggag 137
Query: 67 gtggtgtgtgacgagca 83
||||| || ||||||||
Sbjct: 138 gtggtttgcgacgagca 154
>gnl|LJGI|BW621317 homologue to UniRef100_Q6VAF4 Cluster: Tubulin beta-9 chain; n=1;
Gossypium hirsutum|Rep: Tubulin beta-9 chain - Gossypium
hirsutum (Upland cotton) (Gossypium mexicanum), partial
(29%)
Length = 517
Score = 63.9 bits (32), Expect = 4e-10
Identities = 59/68 (86%)
Strand = Plus / Plus
Query: 1 atgcgtgagattcttcacattcagggagggcagtgtgggaaccagataggatcaaagttc 60
||||||||||| |||||||| ||||| || ||||| || |||||||| ||| | ||||||
Sbjct: 127 atgcgtgagatccttcacatccagggtggccagtgcggcaaccagatcggagccaagttc 186
Query: 61 tgggaagt 68
||||||||
Sbjct: 187 tgggaagt 194
>gnl|LJGI|TC62547 homologue to UniRef100_P37392 Cluster: Tubulin beta-1 chain; n=1;
Lupinus albus|Rep: Tubulin beta-1 chain - Lupinus albus
(White lupin), partial (79%)
Length = 1228
Score = 63.9 bits (32), Expect = 4e-10
Identities = 59/68 (86%)
Strand = Plus / Plus
Query: 1 atgcgtgagattcttcacattcagggagggcagtgtgggaaccagataggatcaaagttc 60
||||||||||| |||||||| ||||| || ||||| || |||||||| ||| | ||||||
Sbjct: 174 atgcgtgagatccttcacatccagggtggccagtgcggcaaccagatcggagccaagttc 233
Query: 61 tgggaagt 68
||||||||
Sbjct: 234 tgggaagt 241
>gnl|LJGI|DC594743 homologue to UniRef100_A7QXE9 Cluster: Chromosome undetermined
scaffold_222, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_222,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (29%)
Length = 471
Score = 61.9 bits (31), Expect = 2e-09
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 1 atgcgtgagattcttcacattcagggagggcagtgtgggaaccagat 47
|||||||||||||||||||| |||||||| || || |||||||||||
Sbjct: 82 atgcgtgagattcttcacatccagggaggacaatgcgggaaccagat 128