Miyakogusa Predicted Gene

Lj4g3v3071660.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v3071660.1 tr|G7L8X1|G7L8X1_MEDTR Polyol transporter
OS=Medicago truncatula GN=MTR_8g103500 PE=3 SV=1,73.28,3e-38,MFS
general substrate transporter,Major facilitator superfamily domain,
general substrate transporte,CUFF.52227.1
         (351 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65736 similar to UniRef100_Q68BJ8 Cluster: Sorbitol t...    54   6e-07

>gnl|LJGI|TC65736 similar to UniRef100_Q68BJ8 Cluster: Sorbitol transporter; n=1;
           Malus x domestica|Rep: Sorbitol transporter - Malus
           domestica (Apple) (Malus sylvestris), partial (41%)
          Length = 719

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 79  tccattctccttggatatgatattggagtgatgagtggagcag 121
           ||||| || ||||| ||||||||||| ||||||||||||||||
Sbjct: 137 tccatcctacttggttatgatattggtgtgatgagtggagcag 179