Miyakogusa Predicted Gene
- Lj4g3v2989020.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2989020.1 Non Chatacterized Hit- tr|B7FK53|B7FK53_MEDTR
Uncharacterized protein OS=Medicago truncatula PE=2 SV,90.91,0,Protein
kinase-like (PK-like),Protein kinase-like domain;
PROTEIN_KINASE_DOM,Protein kinase, catalyt,CUFF.51960.1
(1146 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AV771673 similar to UniRef100_Q84XZ6 Cluster: Mitogen-a... 297 8e-80
gnl|LJGI|AV769070 similar to UniRef100_A7QNJ6 Cluster: Chromosom... 184 8e-46
gnl|LJGI|TC66237 homologue to UniRef100_Q84XZ6 Cluster: Mitogen-... 157 2e-37
gnl|LJGI|AV407818 similar to UniRef100_Q84XZ6 Cluster: Mitogen-a... 149 4e-35
gnl|LJGI|TC61364 similar to UniRef100_Q9ZP91 Cluster: MAP kinase... 80 3e-14
gnl|LJGI|FS347149 homologue to UniRef100_Q3C254 Cluster: Mitogen... 76 5e-13
gnl|LJGI|TC71559 homologue to UniRef100_Q5K6N6 Cluster: Mitogen-... 58 1e-07
gnl|LJGI|TC57262 homologue to UniRef100_Q5K6N6 Cluster: Mitogen-... 58 1e-07
gnl|LJGI|TC57953 homologue to UniRef100_A9YED0 Cluster: Mitogen-... 52 8e-06
>gnl|LJGI|AV771673 similar to UniRef100_Q84XZ6 Cluster: Mitogen-activated protein kinase
4; n=1; Petroselinum crispum|Rep: Mitogen-activated
protein kinase 4 - Petroselinum crispum (Parsley)
(Petroselinum hortense), partial (13%)
Length = 336
Score = 297 bits (150), Expect = 8e-80
Identities = 159/162 (98%)
Strand = Plus / Minus
Query: 985 agtcacccatacctttcatcacttcacaacatcaataacgagccagtttgcccaaggcca 1044
||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 336 agtcacccatacctttcatcacttcacgacatccataacgagccagtttgcccaaggcca 277
Query: 1045 ttcagttttgattttgatcaaccaacatgcactgaagagcaggtcaaggagctcatctgg 1104
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 276 ttcacttttgattttgatcaaccaacatgcactgaagagcaggtcaaggagctcatctgg 217
Query: 1105 aaggaatcagtgaagttcaatccagatccttcgtgtcagtaa 1146
||||||||||||||||||||||||||||||||||||||||||
Sbjct: 216 aaggaatcagtgaagttcaatccagatccttcgtgtcagtaa 175
>gnl|LJGI|AV769070 similar to UniRef100_A7QNJ6 Cluster: Chromosome chr2 scaffold_132,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr2 scaffold_132, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (20%)
Length = 425
Score = 184 bits (93), Expect = 8e-46
Identities = 177/205 (86%)
Strand = Plus / Minus
Query: 929 tagaaaagatgcttatctttgatccaaacaaacgcatcacagttgaagaggcacttagtc 988
|||||||||||||| |||||||||| |||||||| || |||||||| |||||||| |||
Sbjct: 401 tagaaaagatgcttgtctttgatcccaacaaacgtattacagttgatgaggcactatgtc 342
Query: 989 acccatacctttcatcacttcacaacatcaataacgagccagtttgcccaaggccattca 1048
||||||| |||||||| ||||| |||||||| | || |||||| | || | |||||| |
Sbjct: 341 acccatatctttcatcccttcatgacatcaatgatgaaccagttggtcccatgccattta 282
Query: 1049 gttttgattttgatcaaccaacatgcactgaagagcaggtcaaggagctcatctggaagg 1108
||||||||||||| || ||| |||||||||||||||| |||||||||||||||||| |
Sbjct: 281 gttttgattttgagcagccatcatgcactgaagagcacatcaaggagctcatctggagag 222
Query: 1109 aatcagtgaagttcaatccagatcc 1133
|||||||||||| ||| ||||||||
Sbjct: 221 aatcagtgaagtacaacccagatcc 197
>gnl|LJGI|TC66237 homologue to UniRef100_Q84XZ6 Cluster: Mitogen-activated protein
kinase 4; n=1; Petroselinum crispum|Rep:
Mitogen-activated protein kinase 4 - Petroselinum
crispum (Parsley) (Petroselinum hortense), partial (54%)
Length = 881
Score = 157 bits (79), Expect = 2e-37
Identities = 415/527 (78%)
Strand = Plus / Plus
Query: 94 cagtacaatgtgtatggaaacttgttcgaggtgtcctcgaagtatgtgcctcccattcgc 153
||||||||| | ||||| ||| |||||||||| ||| ||||||||| ||||| || ||
Sbjct: 328 cagtacaatatctatggcaacctgttcgaggtttccaagaagtatgtccctcctatccga 387
Query: 154 cccatcggtagaggggcttatggctttgtctgtgctgctgtgaattctgatacacatgaa 213
||| | || ||||| |||||||| |||| ||||||||||| ||| | || |||| |||
Sbjct: 388 cccgtgggaagaggagcttatggtattgtttgtgctgctgtaaatgcggagacacgggaa 447
Query: 214 caagttgccatcaagaagataggtaacacgtttgacaatatcattgatgctaagagaaca 273
||||||| || |||||| | || || | |||||||| | |||||||| || || ||
Sbjct: 448 gaagttgcgataaagaaggttggcaatgcatttgacaacagaattgatgccaaaaggacc 507
Query: 274 ctgagagaaatcaagctccttcgtcacatggatcatgaaaatatcattgccatcaaggat 333
| |||||||||| || ||||| |||||||||||||||||| | || | | | |||
Sbjct: 508 ttacgagaaatcaaacttcttcggcacatggatcatgaaaatgtgataagccttagagat 567
Query: 334 atcatacggccccccaaaaaggagaccttcaatgatgtatacattgtttatgaattgatg 393
|| ||||| || || | ||||| |||||||||||| ||||| ||||||||||| |||
Sbjct: 568 attatacgaccaccacggagggagaacttcaatgatgtgtacatcgtttatgaattaatg 627
Query: 394 gacactgatctgcatcatataattcattctgaccaacctcttagagaggaacattgtcag 453
|| |||||||||||||| ||||| | ||| | ||| || | | || || ||||||| |
Sbjct: 628 gatactgatctgcatcaaataatccgttccaatcaatctttgactgatgatcattgtcgg 687
Query: 454 tacttcttataccagctgctacgggggctgaaatatgtgcactcagctaatgttttgcac 513
|| || || || ||| || |||| || |||||||||||||||||||| |||||| |||||
Sbjct: 688 tattttttgtatcagttgttacgaggtctgaaatatgtgcactcagcaaatgttctgcac 747
Query: 514 cgtgatcttaagcccagtaacttgctgatgaatgcaaactgtgaccttaaaattggagac 573
|||||||| || || || |||||| | ||||||| || ||||| ||||| |||||||||
Sbjct: 748 cgtgatctaaaacctagcaacttgttactgaatgccaattgtgatcttaagattggagac 807
Query: 574 tttggtttggcaaggacaacatctgaaacagatttcatgacagagta 620
|||||| | || || || || || ||||| ||||||||||| |||||
Sbjct: 808 tttggtctcgctagaactacgtccgaaactgatttcatgactgagta 854
>gnl|LJGI|AV407818 similar to UniRef100_Q84XZ6 Cluster: Mitogen-activated protein
kinase 4; n=1; Petroselinum crispum|Rep:
Mitogen-activated protein kinase 4 - Petroselinum
crispum (Parsley) (Petroselinum hortense), partial (25%)
Length = 413
Score = 149 bits (75), Expect = 4e-35
Identities = 216/263 (82%)
Strand = Plus / Plus
Query: 79 ggtggtagatatgcacagtacaatgtgtatggaaacttgttcgaggtgtcctcgaagtat 138
|||||| |||| || ||||||||||| || || ||| | |||||||| ||||| |||||
Sbjct: 143 ggtggtcgatacgcgcagtacaatgtctacggcaacgtcttcgaggtttcctccaagtac 202
Query: 139 gtgcctcccattcgccccatcggtagaggggcttatggctttgtctgtgctgctgtgaat 198
|||||||||||||| ||||| ||||| ||||||||||| |||||| |||| || ||
Sbjct: 203 acccctcccattcgccctatcggaagaggcgcttatggcttcgtctgttctgcggttgat 262
Query: 199 tctgatacacatgaacaagttgccatcaagaagataggtaacacgtttgacaatatcatt 258
|| |||||||| || ||||||| ||||||||||| |||||||| || || || || |||
Sbjct: 263 tcagatacacaagaggaagttgcaatcaagaagatcggtaacacattcgataacataatt 322
Query: 259 gatgctaagagaacactgagagaaatcaagctccttcgtcacatggatcatgaaaatatc 318
|||||||| || || |||| || || | ||| ||||| |||||||||||||| |||||
Sbjct: 323 gatgctaaaaggactttgagggagattatgctgcttcgccacatggatcatgagaatatt 382
Query: 319 attgccatcaaggatatcatacg 341
||||| || ||||||||||||||
Sbjct: 383 attgctattaaggatatcatacg 405
>gnl|LJGI|TC61364 similar to UniRef100_Q9ZP91 Cluster: MAP kinase; n=1; Medicago
sativa|Rep: MAP kinase - Medicago sativa (Alfalfa),
partial (61%)
Length = 766
Score = 79.8 bits (40), Expect = 3e-14
Identities = 340/440 (77%)
Strand = Plus / Plus
Query: 217 gttgccatcaagaagataggtaacacgtttgacaatatcattgatgctaagagaacactg 276
||||| || |||||||| || || ||||||| |||| |||||||||||||| || ||
Sbjct: 251 gttgcgattaagaagattgggaatgcgtttgataataggattgatgctaagaggactctc 310
Query: 277 agagaaatcaagctccttcgtcacatggatcatgaaaatatcattgccatcaaggatatc 336
|||||||||||||| || |||| ||||||||||| ||| | ||| || ||||||||
Sbjct: 311 agagaaatcaagcttctctgtcatatggatcatgataatgttattaagattaaggatata 370
Query: 337 atacggccccccaaaaaggagaccttcaatgatgtatacattgtttatgaattgatggac 396
|| ||||| || | | ||||| || |||||||| || ||||| ||||| ||||||||
Sbjct: 371 attcggccgccggatagggagaattttaatgatgtgtatattgtgtatgagttgatggat 430
Query: 397 actgatctgcatcatataattcattctgaccaacctcttagagaggaacattgtcagtac 456
||||| ||||||| || ||||| ||| |||| |||| | || || || ||||||||
Sbjct: 431 actgacttgcatcagattattcaatctaaccagtctctcactgatgagcactgtcagtat 490
Query: 457 ttcttataccagctgctacgggggctgaaatatgtgcactcagctaatgttttgcaccgt 516
|| | || || || || | || |||| || || ||||| || ||||||||||||||
Sbjct: 491 tttctttatcaactcttaagaggattgaagtacgtccactctgcaaatgttttgcaccga 550
Query: 517 gatcttaagcccagtaacttgctgatgaatgcaaactgtgaccttaaaattggagacttt 576
|| || || || || || || || | |||||||||||||| || ||||| | ||||||
Sbjct: 551 gacctaaaaccaagcaatttacttctcaatgcaaactgtgatctcaaaatatgtgacttt 610
Query: 577 ggtttggcaaggacaacatctgaaacagatttcatgacagagtatgttgtcacacgttgg 636
|| | || || ||||| ||||| ||||| | ||||| ||||||||||| || ||||||
Sbjct: 611 gggcttgccagaacaacctctgagacagaccttatgaccgagtatgttgtgactcgttgg 670
Query: 637 tacagagccccggaattgct 656
||||||||||| || |||||
Sbjct: 671 tacagagcccctgagttgct 690
>gnl|LJGI|FS347149 homologue to UniRef100_Q3C254 Cluster: Mitogen-activated protein
kinase; n=1; Nicotiana tabacum|Rep: Mitogen-activated
protein kinase - Nicotiana tabacum (Common tobacco),
partial (45%)
Length = 709
Score = 75.8 bits (38), Expect = 5e-13
Identities = 371/482 (76%)
Strand = Plus / Minus
Query: 652 ttgcttcttagttgttctgagtacacctctgcaattgatgtttggtctgttggatgcata 711
|||||||||| |||||| || || || | || |||||| | ||||||||||| |||||
Sbjct: 688 ttgcttcttaattgttcagaatatactgcagccattgatatatggtctgttggttgcatc 629
Query: 712 tttggtgaaattttgaccagagaacccatgtttcctgggaaagactatgttcaccaatta 771
| || ||||| |||| || ||||| | |||||||||||||| |||||||| || |
Sbjct: 628 ctcggggaaatcatgacaaggcaacccctatttcctgggaaagattatgttcatcagctc 569
Query: 772 aggcttataactgagttaatagggtcacctgacgatgctagccttggatttctccgaagc 831
|| | || || ||| | ||||| |||||||| || | |||||||||||||| |||||
Sbjct: 568 agattgatcacagagcttataggttcacctgatgacaccagccttggatttctacgaagt 509
Query: 832 gataatgctagaagatactttagacaattccaacaataccggaagcaaaaattctcagct 891
||||||||| | ||||| | |||||| | | |||||| | | |||| | || | |||
Sbjct: 508 gataatgctcgtagatatgtaagacaacttccacaatatccaaggcaacagtttgctgct 449
Query: 892 agattccctaacatgttgcctgaggcattagatctgttagaaaagatgcttatctttgat 951
||||| || ||||||| ||| ||| | ||| ||||||| ||||||||| | ||||||
Sbjct: 448 agatttcccaacatgtctgctggtgcagttgatttgttagagaagatgcttgtatttgat 389
Query: 952 ccaaacaaacgcatcacagttgaagaggcacttagtcacccatacctttcatcacttcac 1011
||||||| |||||| |||||||| ||||| || | ||||| ||| | || | || ||
Sbjct: 388 ccaaacagacgcattacagttgatgaggctctgtgccacccttacttggcacctctccat 329
Query: 1012 aacatcaataacgagccagtttgcccaaggccattcagttttgattttgatcaaccaaca 1071
|| || ||| | || || |||||||| || || ||||||||||||||||| ||||| |
Sbjct: 328 aatattaatgaggaacctgtttgccctagacctttcagttttgattttgagcaaccgtct 269
Query: 1072 tgcactgaagagcaggtcaaggagctcatctggaaggaatcagtgaagttcaatccagat 1131
| ||||||||| | ||||||| |||||||||| || || ||||| |||||||| |||
Sbjct: 268 ttcactgaagaagatatcaaggaactcatctggagagagtccgtgaacttcaatcctgat 209
Query: 1132 cc 1133
||
Sbjct: 208 cc 207
>gnl|LJGI|TC71559 homologue to UniRef100_Q5K6N6 Cluster: Mitogen-activated protein
kinase 2; n=1; Glycine max|Rep: Mitogen-activated
protein kinase 2 - Glycine max (Soybean), partial (31%)
Length = 513
Score = 58.0 bits (29), Expect = 1e-07
Identities = 128/161 (79%)
Strand = Plus / Plus
Query: 154 cccatcggtagaggggcttatggctttgtctgtgctgctgtgaattctgatacacatgaa 213
|||||||| | ||| ||||| ||| | |||||| ||||| |||| || || ||| ||||
Sbjct: 332 cccatcggcaaaggagcttacggcatcgtctgttctgctttgaactcggagacaaatgag 391
Query: 214 caagttgccatcaagaagataggtaacacgtttgacaatatcattgatgctaagagaaca 273
|| ||||| ||||||||||| | || | |||||||| | |||||||| ||||| ||
Sbjct: 392 catgttgctatcaagaagattgccaatgcatttgacaacaagattgatgccaagaggact 451
Query: 274 ctgagagaaatcaagctccttcgtcacatggatcatgaaaa 314
|| | || |||||||| ||||| |||||||||||||||||
Sbjct: 452 ctccgtgagatcaagctgcttcgccacatggatcatgaaaa 492
>gnl|LJGI|TC57262 homologue to UniRef100_Q5K6N6 Cluster: Mitogen-activated protein
kinase 2; n=1; Glycine max|Rep: Mitogen-activated
protein kinase 2 - Glycine max (Soybean), partial (72%)
Length = 1007
Score = 58.0 bits (29), Expect = 1e-07
Identities = 128/161 (79%)
Strand = Plus / Plus
Query: 154 cccatcggtagaggggcttatggctttgtctgtgctgctgtgaattctgatacacatgaa 213
|||||||| | ||| ||||| ||| | |||||| ||||| |||| || || ||| ||||
Sbjct: 354 cccatcggcaaaggagcttacggcatcgtctgttctgctttgaactcggagacaaatgag 413
Query: 214 caagttgccatcaagaagataggtaacacgtttgacaatatcattgatgctaagagaaca 273
|| ||||| ||||||||||| | || | |||||||| | |||||||| ||||| ||
Sbjct: 414 catgttgctatcaagaagattgccaatgcatttgacaacaagattgatgccaagaggact 473
Query: 274 ctgagagaaatcaagctccttcgtcacatggatcatgaaaa 314
|| | || |||||||| ||||| |||||||||||||||||
Sbjct: 474 ctccgtgagatcaagctgcttcgccacatggatcatgaaaa 514
Score = 58.0 bits (29), Expect = 1e-07
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 361 ttcaatgatgtatacattgtttatgaattgatggacactga 401
||||||||||| ||||||| ||||||||||||||||||||
Sbjct: 561 ttcaatgatgtttacattgcatatgaattgatggacactga 601
>gnl|LJGI|TC57953 homologue to UniRef100_A9YED0 Cluster: Mitogen-activated protein
kinase 3; n=1; Arachis hypogaea|Rep: Mitogen-activated
protein kinase 3 - Arachis hypogaea (Peanut), complete
Length = 1472
Score = 52.0 bits (26), Expect = 8e-06
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 673 tacacctctgcaattgatgtttggtctgttggatgcat 710
|||||||||||||| ||||| ||||||||||| |||||
Sbjct: 746 tacacctctgcaatagatgtgtggtctgttggctgcat 783