Miyakogusa Predicted Gene
- Lj4g3v2800420.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj4g3v2800420.1 tr|G7LB96|G7LB96_MEDTR ABC transporter-like
protein OS=Medicago truncatula GN=MTR_8g091710 PE=4 SV=1,86.66,0,no
description,NULL; coiled-coil,NULL; SUBFAMILY NOT NAMED,NULL;
CHAPERONE-ACTIVITY OF BC1 COMPLEX (,CUFF.51712.1
(2124 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|GO011651 homologue to UniRef100_Q0WLU3 Cluster: ABC tra... 745 0.0
gnl|LJGI|TC63828 similar to UniRef100_Q9LV84 Cluster: ABC transp... 145 1e-33
gnl|LJGI|TC77546 homologue to UniRef100_A7PL29 Cluster: Chromoso... 92 2e-17
gnl|LJGI|GO008514 62 2e-08
>gnl|LJGI|GO011651 homologue to UniRef100_Q0WLU3 Cluster: ABC transporter-like; n=1;
Arabidopsis thaliana|Rep: ABC transporter-like -
Arabidopsis thaliana (Mouse-ear cress), partial (50%)
Length = 683
Score = 745 bits (376), Expect = 0.0
Identities = 603/683 (88%)
Strand = Plus / Plus
Query: 1135 gggagatatgctgttgagtcttacttggagcagattctatcacatggtttcttccatgct 1194
||||||||||| |||||||| |||||||| || ||||||||||||||||||||||| |||
Sbjct: 1 gggagatatgcggttgagtcatacttggaacaaattctatcacatggtttcttccacgct 60
Query: 1195 gaccctcatcctggaaatattgcagttgatgatgtcaatggtggaagattgatcttttat 1254
|| ||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||
Sbjct: 61 gatcctcatcctgggaatattgcagttgatgatgtcaatggtggaaggttgatcttctat 120
Query: 1255 gattttggaatgatgggaagtatcagtcaaaatatccgagaaggtttacttgaaactttt 1314
|||||||||||||||||||||||||||| ||| |||||||||||||| |||||||| |||
Sbjct: 121 gattttggaatgatgggaagtatcagtccaaacatccgagaaggtttgcttgaaacattt 180
Query: 1315 tatggagtttatgagaaggatccagataaggtccttcaagcaatgattcaaatgggcgtt 1374
||||||||||||||||| ||||| |||||||| |||||| ||||||||||||||||||||
Sbjct: 181 tatggagtttatgagaaagatcccgataaggttcttcaatcaatgattcaaatgggcgtt 240
Query: 1375 cttgtcccaactggagatatgactgccgttagacgaacagcacagttcttcctcaatagt 1434
|||||||| |||||||| |||||||| ||||| ||||||||||| |||||||| || |||
Sbjct: 241 cttgtccctactggagacatgactgctgttaggcgaacagcacaattcttccttaacagt 300
Query: 1435 tttgaagagcgtctggttgcacaaagnnnnnnnnnnnnnttggctgcagctgaactggga 1494
||||| |||||||||| ||||||||| || |||||||||| |||
Sbjct: 301 tttgaggagcgtctggctgcacaaaggagggaaagagaagaagcaacagctgaacttgga 360
Query: 1495 ttcaaaaagccactaagcaaagaggaaaaagtaatgaagaagaaagaacgtctggctgct 1554
|||||||| ||| ||||||| ||||||||| |||||| ||||||| ||||||||||||||
Sbjct: 361 ttcaaaaaaccattaagcaaggaggaaaaaataatgaggaagaaacaacgtctggctgct 420
Query: 1555 attggtgaagatttattatccattgcagcagaccagcccttccggtttcctgcgacattc 1614
|| || || ||||||||||||||||||||||||||||||||||| |||||||| || |||
Sbjct: 421 ataggcgaggatttattatccattgcagcagaccagcccttccgatttcctgctacgttc 480
Query: 1615 acatttgttgttagagccttctcagtgttagatggcattggaaagggccttgacgcccgt 1674
||||||||||||||||| |||||||| ||||||||||| ||||||||||| ||| | |||
Sbjct: 481 acatttgttgttagagctttctcagtattagatggcatcggaaagggcctcgacccacgt 540
Query: 1675 tttgatattactgagattgccaaaccttatgccctggagttgctgaaattccgtgaggca 1734
||||| ||||||||||||||||| |||||||| ||||||||||| | || ||||| ||
Sbjct: 541 tttgacattactgagattgccaagccttatgctctggagttgctaaggtttcgtgaagcg 600
Query: 1735 ggagttgaagttgtcctaaaggacttcagaaagagatgggacagacaatctcaagcattt 1794
|| | ||| ||| ||||||||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 601 ggggctgaggttatcctaaaggactttaggaagagatgggatagacaatctcaagcattt 660
Query: 1795 tataacttatttagacaggctga 1817
|| ||||||||||||||||||||
Sbjct: 661 tacaacttatttagacaggctga 683
>gnl|LJGI|TC63828 similar to UniRef100_Q9LV84 Cluster: ABC transporter-like; n=1;
Arabidopsis thaliana|Rep: ABC transporter-like -
Arabidopsis thaliana (Mouse-ear cress), partial (10%)
Length = 727
Score = 145 bits (73), Expect = 1e-33
Identities = 241/297 (81%)
Strand = Plus / Plus
Query: 243 gaggaagaggaggttggaggagattggtaaagaagatgcgtggtttaaacaaagtaagga 302
||||||||||||||||||||||||||| ||||| |||||||||||||| |||| | | |
Sbjct: 427 gaggaagaggaggttggaggagattgggaaagaggatgcgtggtttaagcaaactgtgaa 486
Query: 303 accgcaggttgaggtggcggttgcgcctggaggtcgttggagcaggttcaagacttactc 362
| |||| |||| || ||||| ||||||||||||||||||||||||||| ||||||
Sbjct: 487 agaatcggttcaggttgcagttgcacctggaggtcgttggagcaggttcaagggttactc 546
Query: 363 cactatacagagaacgttggagatttggggatttgtcatcacatttgtcttcaagtcttg 422
|| |||||||| || ||||| |||||||||||||| | | ||| |||| ||| |||
Sbjct: 547 tacaatacagaggaccttggaaatttggggatttgttgtgaagtttatctttaaggtttg 606
Query: 423 gctggatagtaagaagttttcgtatagaggaggaatgactgaggaaaagcaaaaattgag 482
|||| | |||||||| || | ||||||||||||||||||||| | | || ||
Sbjct: 607 gctgagcaaccagaagtttagttacaaaggaggaatgactgaggaaaaaaagaccttaag 666
Query: 483 gcgaaaggcccttgccaagtggctgaaggaaagcattctaagattaggtcctacgtt 539
|| || ||||||||||||||||||||||||||||| | ||||||||||| |||||
Sbjct: 667 acggaaaacccttgccaagtggctgaaggaaagcattttgagattaggtccaacgtt 723
>gnl|LJGI|TC77546 homologue to UniRef100_A7PL29 Cluster: Chromosome chr7 scaffold_20,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr7 scaffold_20, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (5%)
Length = 669
Score = 91.7 bits (46), Expect = 2e-17
Identities = 79/90 (87%)
Strand = Plus / Plus
Query: 2032 tgtgcaatctttggttttcaagttctctttggcattttcaagatcaagaagttagatgaa 2091
|||||| |||||||||||||||| ||||| |||||| | ||| |||||||| ||||||||
Sbjct: 27 tgtgcattctttggttttcaagtgctcttgggcattgtaaaggtcaagaagctagatgaa 86
Query: 2092 cgggaacggttgattacagggacagcataa 2121
||||||| ||||||||||||| ||||||
Sbjct: 87 agggaacgactgattacagggaccgcataa 116
>gnl|LJGI|GO008514
Length = 580
Score = 61.9 bits (31), Expect = 2e-08
Identities = 46/51 (90%)
Strand = Plus / Plus
Query: 890 agagggattgggttgctatttatgatgaatgtgcctctgttttatatcagg 940
|||||| |||||||||||||||||||||||||| ||| || ||||| ||||
Sbjct: 258 agaggggttgggttgctatttatgatgaatgtgtctccgtcttataccagg 308