Miyakogusa Predicted Gene

Lj4g3v2785750.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2785750.1 Non Chatacterized Hit- tr|I1KTB9|I1KTB9_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.26847
PE,79.5,0,seg,NULL; WRKY,DNA-binding WRKY; WRKY DNA-binding
domain,DNA-binding WRKY; no description,DNA-bindin,CUFF.51624.1
         (714 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC64786 similar to UniRef100_A7LHF5 Cluster: WRKY5; n=1...    52   5e-06

>gnl|LJGI|TC64786 similar to UniRef100_A7LHF5 Cluster: WRKY5; n=1; Glycine max|Rep:
           WRKY5 - Glycine max (Soybean), partial (66%)
          Length = 911

 Score = 52.0 bits (26), Expect = 5e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 481 gatgatggctacaagtggaggaagtatggacagaaagt 518
           ||||||||||| | ||||||||| ||||||||||||||
Sbjct: 240 gatgatggctataggtggaggaaatatggacagaaagt 277