Miyakogusa Predicted Gene

Lj4g3v2785740.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj4g3v2785740.2 Non Chatacterized Hit- tr|I1KTC2|I1KTC2_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,86.34,0,Six-hairpin
glycosidases,Six-hairpin glycosidase-like; Glyco_hydro_100,Glycosyl
hydrolase family 100,CUFF.51637.2
         (1815 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81235 similar to UniRef100_A7Q8U5 Cluster: Chromosome...    68   2e-10
gnl|LJGI|AV426467 similar to UniRef100_A7LH71 Cluster: Neutral i...    56   8e-07

>gnl|LJGI|TC81235 similar to UniRef100_A7Q8U5 Cluster: Chromosome chr5 scaffold_64,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr5 scaffold_64, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (25%)
          Length = 917

 Score = 67.9 bits (34), Expect = 2e-10
 Identities = 100/122 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1492 aagatttgttatcctgctcttgaaggtcaggagtggcagataatcaccggcagcgatccc 1551
            ||||| |||||||| || || || ||| |||| ||||  |||||||| || || || |||
Sbjct: 82   aagatatgttatccagcgctggagggtgaggaatggcgtataatcactggaagtgacccc 141

                                                                        
Query: 1552 aagaacactccttggtcctaccataatgcaggctcctggccaacactgctctggcagctc 1611
            |||||||| |||||||| || |||||||  || || ||||||||||| ||||||||| ||
Sbjct: 142  aagaacaccccttggtcatatcataatggtgggtcttggccaacacttctctggcagttc 201

              
Query: 1612 ac 1613
            ||
Sbjct: 202  ac 203


>gnl|LJGI|AV426467 similar to UniRef100_A7LH71 Cluster: Neutral invertase; n=1; Vitis
            vinifera|Rep: Neutral invertase - Vitis vinifera (Grape),
            partial (16%)
          Length = 330

 Score = 56.0 bits (28), Expect = 8e-07
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 1162 gctctttcatttcacattagagaatattattggattgatttgaaaaag 1209
            ||||| ||||| ||||||||||||||||||||| | ||| ||||||||
Sbjct: 91   gctctatcattccacattagagaatattattgggtggatatgaaaaag 138